Midori green

DNA binding of p34ct was investigated using native agarose gels in 25 mM Tris-HCl pH 8.5 and 19.2 mM glycine. To prepare dsDNA substrates two 50-mer oligonucleotides (NDT, GACTACGTACTGTTACGGCTCCATCTCTACCGCAATCAGGCCAGATCTGC and NDB, GCAGATCTGGCCTGATTGCGGTAGAGATGGAGCCGTAACAGTACGTAGTC) were annealed by incubating the mixture in 100 mM KCl at 85 °C for 10 min followed by slowly cooling the samples to room temperature. For interaction studies 1 – 2 µM of ssDNA (NDB) or dsDNA (NDT/NDB) were used with 10 – 20 µM protein in a total reaction volume of 10 µl. The samples were incubated for 20 – 30 min at 4 °C and then supplemented by 10 µl loading dye, followed by an additional incubation for 10 min at 4 °C. Finally 20 µl of each sample were loaded onto 0.8% agarose gels, which were run at 50 V and 4 °C for 4 – 6 hours. Midori Green (Biozym Scientific) was used to visualize the DNA. As positive control for ssDNA and dsDNA binding we used DNA Polymerase I from Bacillus caldotenax.

Whole–blood samples were collected from participants in EDTA–coated tubes (BD Vacutainer, K3E, 7.2 mg. REF 368,884) and stored at 4 °C. Genomic DNA was extracted from whole blood using the GeneMole automated system (Mole Genetics AS, Lysaker, Norway) according to the manufacturer’s protocol. Genotyping was performed using PCR followed by allele–specific restriction analysis. Briefly, the DNA fragment on chromosome 11p14.1 containing the BDNF val66met polymorphism (NCBI accession number: rs6265) was amplified using the primers BDNF_rs6265_f (forward): 5′- GCA TCC CGG TGA AAG AAA GCC CTA AC-3′ and BDNF_rs6265_r (reverse): 5′- GCC CCT GCA GCC TTC TTT TGT GTA AC-3′, and standard Taq polymerase (Qiagen). The resulting PCR products were digested with the PmaCI isoschizomer Eco721 (ThermoFisher Scientific), yielding two allele-specific amplicons (398 + 278 bp) for the more common Val allele, and the entire region (676 bp) for the less common Met allele. DNA fragments were separated on a 2.5% agarose gel stained with Midori Green (Biozym Scientific, Hessisch Oldendorf, Germany) and visualized under UV light.

To distinguish the Inc types of possible plasmids, 2 or 3 colonies of fresh cultures of all K. oxytoca isolates were resuspended in 100 μl of nuclease-free water, heated to 95°C for 10 min, and centrifuged at 14,000 × g for 5 min. The supernatant was carefully removed and used for PCR. The PCR mixture contained 2× OneTaq master mix (New England Biolabs) and 0.2 μM each primer (Table 4) (39 (link)– (link)41 (link)).
The PCR conditions were set at 94°C for 3 min, followed by 30 cycles of 94°C for 30 s, 60°C for 30 s, and 68°C for 1 min. The final extension was performed at 68°C for 5 min. The PCR products were analyzed using agarose gel electrophoresis on a 1% agarose-TBE gel and were stained with Midori green (Biozym Scientific GmbH).

Genomic DNA was isolated using the Quick DNA Miniprep kit (Zymo research, Freiburg, Germany) according to the manufacturer’s protocol. PCR amplification was performed using H3F3A wild-type and H3F3A-G34W specific primer, respectively. The reaction consisted of 2 U Platinum Taq polymerase (Thermo Fisher Scientific, Dreieich, Germany), 0.6 µl MgCl₂ (50 mM), 0.4 µl dNTPs (10 mM each), 0.5 µl of each primer (10 µM) and 100 ng genomic DNA as template in a total volume of 20 µl. Samples were incubated at 94 °C for 3 min followed by 34 cycles of denaturation at 94 °C for 15 s, annealing at 66 °C for 20 s and extension at 72 °C for 30 s and a final extension step at 72 °C for 7 min. PCR products were separated on a 1.6% agarose gel, visualized by Midori Green (Biozym, Hessisch Oldendorf, Germany) and imaged. All primers are listed in Supplementary Data 5.

The larva collected in 2016 was identified via the sequencing of a fragment of the mitochondrial nad4 gene in addition to morphological identification. DNA extraction (QuickExtract Extraction Solution, Epicentre, Madison, WI, USA) was performed according to the manufacturer’s protocol and the extracted DNA was kept frozen at -20 °C until further use.
A region within the nad4 sequence was amplified by PCR [29 (link)] using the following reagents: 5× Q5 OneTaq Standard Reaction Buffer (New England BioLabs, Ipswich, MA, USA; final concentration: 1×), 1.25 U of OneTaq Hot Start DNA Polymerase (New England BioLabs), 200 μM each of dNTP (‘dNTP-Mix 25 mM’, Biozym, Hessisch Oldendorf, Germany) and the primers N4J-8502D and N4N-8944D in final concentrations of 0.3 μM.
An initial denaturation (30 s at 94 °C) was followed by 35 cycles of denaturation at 94 °C for 15 s, annealing at 53 °C for 45 s and elongation at 68 °C for 60 s. The cycling ended with a final elongation step at 68 °C for 5 min.
After checking the size of the PCR product via agarose gel electrophoresis (2%, pre-stained with MidoriGreen, Biozym) the amplicon was prepared for sequencing using the Monarch PCR & DNA cleanup-kit (New England BioLabs) following the manufacturer’s protocol. Sequencing was carried out by Eurofins Genomics (Ebersberg, Germany).

Possible ESBL production was confirmed by PCR. Five specific primer sets were used to detect beta-lactamase-encoding genes belonging to the bla_TEM, bla_SHV, and bla_CTX-M families (35 (link)– (link)38 (link)). The PCR products were visualized by gel electrophoresis on a 1% agarose-Tris-borate-EDTA (TBE) gel and stained with Midori green (Biozym Scientific GmbH, Hessisch Oldendorf, Germany). The resulting amplicons were purified using an innuPREP DOUBLEpure kit (Analytik Jena AG, Jena, Germany), according to the manufacturer’s recommendations. Custom sequencing was performed by Microsynth (Göttingen, Germany). The nucleotide sequences were analyzed using Chromas 2.6.5.

IRE1α endoribonuclease activity is involved in the degradation of mRNA substrates and in the unconventional splicing of Xbp1 mRNA. The latter was monitored using cDNA from brain biopsies and from cells by incubation with Xbp1 primers to amplify an Xbp1 amplicon spanning the 26 nt intron from the cDNA samples in a regular 3-step PCR. Thermal cycles were: 5 min at 95 °C, 30 cycles of 30 s at 95 °C, 30 s at 60 °C, and 1 min at 72 °C, followed by 72 °C for 15 min, and a 4 °C hold. PCR was performed using m-XBP1.3 fwd: AAA CAG AGT AGC AGC GCA GAC TGC and h-XBP1.12 rev: TCC TTC TGG GTA GAC CTC TGG GAG primers. PCR products were then digested by PstI resolved by agarose gel (2.5%) electrophoresis and visualized using Midori Green (Biozym Scientific #617004, 31840 Hessisch Oldendorf, Germany) and UV transillumination. The restriction digest of unspliced Xbp1 (Xbp1u) resulted in two fragments of 290 and 183 bp. The size of the Xbp1s amplicon lacking PstI sites was 473 bp.