Total RNA was extracted with Trizol reagent (Invitrogen) according to standard protocol. Concentration and quality of all RNA samples were evaluated by Nanodrop 2000 (Thermo). MasterMix kit (Takara) and TaqMan reverse transcription kit (Life Technology, USA) were used for mRNA and miRNA reverse transcription. Universal SYBR Green Master mix (Applied Biosystems) and TaqMan specific microRNA probe (Life technology) were used for qPCR assays. All qPCR were performed by StepOnePlus real-time PCR system (Applied Biosystems). GAPDH and U6 snoRNA were used for normalization of mRNA and miRNA.
Taqman specific microrna probe
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan
The TaqMan specific microRNA probe is a molecular biology tool designed for the detection and quantification of specific microRNA sequences. It consists of a short DNA or RNA oligonucleotide with a fluorescent reporter dye and a quencher dye attached. The probe is designed to hybridize to a complementary target microRNA sequence, allowing for real-time detection and measurement of the target microRNA expression levels.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Mastermix kit, by Takara Bio (4 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (3 mentions)
Sybr green universal master mix, by Thermo Fisher Scientific (3 mentions)
Taqman reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Mirna first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr kit, by Takara Bio (1 mentions)
4 protocols using taqman specific microrna probe
1
Comprehensive Total RNA Extraction and Quantification
2
RNA Extraction and Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol reagent (Invitrogen, USA) according to standard protocol. The concentration and quality of all RNA samples were evaluated using Nanodrop 2000 (Thermo, USA), and the 260/280 and 260/230 values of all samples were above 1.8 and 1.9, respectively. Reverse transcription of mRNA was performed with MasterMix kit (Takara, Japan), whereas miRNA reverse transcription was performed with TaqMan reverse transcription kit (Life technology, USA) following the standard manuals. Quantitative PCR of gene was performed using Universal SYBR Green Master mix (Applied Biosystems, USA) and microRNA qPCR was performed using TaqMan-specific microRNA probe (Life technology) on a StepOnePlus real-time PCR system (Applied Biosystems). Gene expression was normalized with GAPDH and miRNA expression was normalized with U6 snoRNA unless otherwise stated.
3
Comprehensive RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen) according to the standard protocol. The concentration and quality of all RNA samples were evaluated using NanoDrop 2000 (Thermo). Reverse transcription of mRNA was performed using a MasterMix kit (Takara), and miRNA reverse transcription was performed using a TaqMan reverse transcription kit (Life Technologies) following the manufacturer’s instructions. qPCR of genes was performed using Universal SYBR Green Master mix (Applied Biosystems), and miRNA qPCR was performed using TaqMan-specific microRNA probe (Life Technologies) on a 7500 real-time PCR system (Applied Biosystems). Gene expression was normalized to GAPDH, and miRNA expression was normalized to U6 small nucleolar RNA (snoRNA) unless otherwise stated. Primer sequences are listed in the Supplemental Information .
4
Quantifying miRNA and mRNA Expressions in GC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative miRNA (miR-498) and mRNA (CEACAM5) expressions in GC cells were estimated via qRT-PCR. The total RNAs in transfected cells were extracted with the aid of a TRIzol reagent (Invitrogen, USA). Afterward, Master Mix kit (Takara, USA) and miRNA First-Strand cDNA Synthesis Kit (Invitrogen, USA) were employed to synthesize cDNA from mRNAs and miRNAs, respectively, through reverse transcription. The ABI 7500 detection system, SYBR Green PCR Kit (Takara, Japan), and TaqMan specific microRNA probe (Life technology, USA) were utilized for the qRT-PCR. The reaction was carried out with the following conditions: 94 °C for 10 s, 60 °C for 30 s, 68 °C for 2 min, 40 cycles. GAPDH and U6 were adopted to normalize the data. The relative expressions were calculated by applying the 2−ΔΔCt approach [20] . We listed the primer information in Table 1 .Table 1
The sequences of primers.
| Gene name | Sequence (5’- 3’) |
|---|---|
| CEACAM5 | F: GCCTCAATAGGACCACAGTCAC |
| R: CAGGTTAAGGCTACAGCATCCTC | |
| miR-498 | F: TTTCAAGCCAGGGGGCGTTTTTC |
| R: GCTTCAAGCTCTGGAGGT GCTTTTC | |
| GAPDH | F: AAGCCGATCTACGCGCGGAGAGCGCC |
| R: CCTAGCGACGGCGGCTTAGCGAACCCG | |
| U6 | F: GCACATTCTCCCCAGTTATGA |
| R: TCACAAATTTGCATGTCATCCT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!