Abi seqscape software

ExoSAP-IT was used for the clean-up of the λ-DNA PCR products (410bp and 309bp) according to the manufacturer’s instructions (Affymetrix, Santa Clara, CA, USA). The two λ-DNA PCR products were covered both by forward and reverse strand sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA) and the ABI 3130xl Genetic Analyzer (Applied Biosystems) according to the manufacturer's protocol. The sequencing primers were the same as those used for the PCR amplification. Sequence traces were automatically compared with the in silico converted λ-DNA sequences using the ABI SeqScape software (Applied Biosystems). Chromatograph traces (.abi) were analyzed using the ESME analysis software [34 (link)].

Genomic DNA sequencing of the candidate variants in CLN6 was performed as previously described (Nicolaou et al., 2008 (link)). PCR primers were designed using the Primer3 program (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) and are available upon request. PCR amplification of candidate genes was performed using standard methods, and PCR products were purified with ExoSAP-IT for PCR product clean-up (Affymetrix, Santa Clara, CA, USA). Relevant PCR products were covered by both forward and reverse strand sequencing using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA) and the ABI 3130xl Genetic Analyzer (Applied Biosystems) according to the manufacturer’s protocol. Sequence traces were automatically compared with the normal gene sequences as listed in the GenBank database, using ABI SeqScape software (Applied Biosystems).
All available family members were analyzed for the identified variants to obtain direct evidence of the variant and its co-segregation with the disease in the family. Furthermore, 150 Cypriot control samples were checked for the identified variants.

Genomic DNA was isolated from whole blood and applied to the Illumina Human Omni2.5-8 Beadchip ver 1.1 SNP chips (cases) or Illumina Human Omni2.5-8 Beadchip ver 1.0 (controls Phase 2) SNP arrays. Genotyping conditions were as described in the manufacturer’s manual.
Validation genotyping was carried out at Keio University by Sanger sequencing of PCR products generated with forward primer 5’- GCAATGCTGCTTTGTTTCTCTG -3’ and reverse primer 5’ - TGACTGAGACTAGTGGGGAGTC-3’. The appropriate temperature for successful resolution were determined by the dHPLC melting algorithm. Samples with an altered dHPLC profile were sequenced using the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster city, CA) on an ABI 3730xl DNA sequencer (Applied Biosystems). The resulting sequences were compared with the reference sequence of the SNPs sites with the ABI SeqScape software (Applied Biosystems).