Total RNA was isolated by a single step of guanidinium isothiocyanate/phenol extraction using PureZol RNA isolation reagent (Bio-Rad Laboratories, Segrate, Italy) according to the manufacturer’s instructions and quantified by spectrophotometric analysis. An aliquot of each sample was then treated with DNase (ThermoFisher Scientific, Monza, Italy) to avoid DNA contamination. The samples were processed for real-time polymerase chain reaction (RT-PCR) to assess Arc, c-Fos, Gadd45β, Npas4, Nr4a1 and Zif268 mRNA levels. RNA was analyzed by TaqMan qRTPCR instrument (CFX384 real time system, Bio-Rad Laboratories, Segrate, Italy) using the iScriptTM one-step RT-PCR kit for probes (Bio-Rad Laboratories, Segrate, Italy). Samples were run in 384-well formats in triplicate as multiplexed reactions with a normalizing internal control (36B4). A comparative cycle threshold (Ct) method was used to calculate the relative target gene expression. Primer sequences used were purchased from Eurofins MWG-Operon (Table 1 ) and Life Technologies (Table 2 ).
Taqman qrt pcr instrument cfx384 real time system
Manufactured by Bio-Rad
Sourced in Italy
The TaqMan qRT-PCR instrument (CFX384 real time system) is a real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) system. It is designed to perform quantitative gene expression analysis and other real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Iscript one step rt pcr kit for probes, by Bio-Rad (5 mentions)
Purezol rna isolation reagent, by Bio-Rad (3 mentions)
Dnase, by Thermo Fisher Scientific (3 mentions)
Six well plate, by Thermo Fisher Scientific (1 mentions)
Rneasy plus micro kit, by Qiagen (1 mentions)
Allprep dna rna mini kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
6 protocols using taqman qrt pcr instrument cfx384 real time system
1
Quantification of Neuronal Gene Expression
2
Cytokine-Induced Gene Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were plated on six well plates (Nunclon) at a density of 4.5 × 105 cells per well. After 2d pre-treatment with media (without EPA or DHA), followed by 1 day co-treatment with EPA- or DHA-derived lipid metabolites and either IL1β, IL6 or IFN-α (concentrations as above), RNA was isolated using RNeasy Plus Micro Kit (Quiagen) and both target (STAT1, NF-kB and aquaporin 4 (AQP4)) and housekeeping genes (ribosomal protein L13A and beta-actin) expression levels were analysed by TaqMan qRT-PCR instrument (CFX384 real time system, Bio-Rad, California, USA), as reported in our previous publication [20 ] (see also Supplementary Materials ).
3
Quantifying Mitochondrial and Antioxidant Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by a single step of guanidinium isothiocyanate/phenol extraction using PureZol RNA isolation reagent (Bio-Rad Laboratories, Segrate, Italy) (Brivio et al., 2021 (link)). Real-time polymerase chain reaction (RT-PCR) was performed to assess Cytochrome c oxidase 1 (Cox1) (Rn03296721_s1), Cox3 (Rn03296820_s1), Catalase (Cat) (Rn00560930_m1), and Glutathione peroxidase 1 (Gpx1) (Rn00577994_g1, Thermo Fisher Scientific, Monza, Italy) mRNA levels. RNA was analyzed by TaqMan qRT-PCR instrument (CFX384 real-time system, Bio-Rad Laboratories, Segrate, Italy) using the iScriptTM one-step RT-PCR kit for probes (Bio-Rad Laboratories, Italy). Samples were run in 384 well formats in triplicate as multiplexed reactions with the normalizing internal control 36B4 (primer fw TCAGTGCCTCACTCCATCAT, primer rev AGGAAGGCCTTGACCTTTTC, probe TGGATACAAAAGGGTCCTGG, Eurofins genomics, Vimodrone, Italy). A comparative cycle threshold (Ct) method was used to calculate the relative target gene expression.
4
Rat PFC RNA Isolation and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from rat PFC using AllPrep DNA/RNA Mini kit (Qiagen). RNA was analyzed by TaqMan qRT-PCR instrument (CFX384 real-time system, Bio-Rad Laboratories, Segrate, Italy) using the iScriptTM one-step RT-PCR kit for probes (Bio-Rad Laboratories) in triplicate as multiplexed reactions with a normalizing internal control (36b4).
5
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Qiagen RNeasy Mini kit (Qiagen, Italia) according to the manufacturer's instructions, and quantified by spectrophotometric analysis.
An aliquot of each sample was then treated with DNase to avoid DNA contamination. RNA was analysed by TaqMan qRT-PCR instrument (CFX384 real-time system, Bio-Rad Laboratories) using the iScript one-step RT-PCR kit for probes (Bio-Rad Laboratories). The samples were run in 384-well formats in triplicates as multiplexed reactions with 36B4 as a normalizing internal control, since its expression was not affected by prenatal injection and further manipulations.
Thermal cycling was initiated with an incubation at 50°C for 10 min (RNA retrotranscription) and then at 95°C for 5 min (TaqMan polymerase activation). After this initial step, 39 cycles of PCR were performed.
Each PCR cycle consisted of heating the samples at 95°C for 10 s to enable the melting process and then for 30 s at 60°C for the annealing and extension reaction. Relative target gene expression was calculated according to the 2 (-∆∆Ct) method. The probe and primer sequences used are summarized in Table S2.
An aliquot of each sample was then treated with DNase to avoid DNA contamination. RNA was analysed by TaqMan qRT-PCR instrument (CFX384 real-time system, Bio-Rad Laboratories) using the iScript one-step RT-PCR kit for probes (Bio-Rad Laboratories). The samples were run in 384-well formats in triplicates as multiplexed reactions with 36B4 as a normalizing internal control, since its expression was not affected by prenatal injection and further manipulations.
Thermal cycling was initiated with an incubation at 50°C for 10 min (RNA retrotranscription) and then at 95°C for 5 min (TaqMan polymerase activation). After this initial step, 39 cycles of PCR were performed.
Each PCR cycle consisted of heating the samples at 95°C for 10 s to enable the melting process and then for 30 s at 60°C for the annealing and extension reaction. Relative target gene expression was calculated according to the 2 (-∆∆Ct) method. The probe and primer sequences used are summarized in Table S2.
6
Quantification of Stress-Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using PureZol RNA isolation reagent (Bio-Rad Laboratories, Italy) and quanti ed by spectrophotometric analysis as previously described [17] (link). An aliquot of each sample was treated with DNase (ThermoFisher scienti c, Italy) to avoid DNA contamination. Real-time polymerase chain reaction (RT-PCR) was performed to assess Arc, Cfos, Gadd45b, Sgk1, Dusp1, Nr4a1 mRNA levels. RNA was analyzed by TaqMan qRT-PCR instrument (CFX384 real time system, Bio-Rad Laboratories, Italy) using the iScriptTM one-step RT-PCR kit for probes (Bio-Rad Laboratories, Italy) (see [18] for details). Samples were run in 384 well formats in triplicate as multiplexed reactions with the normalizing internal control 36B4 (the primers and probes sequences are listed in Table1). A comparative cycle threshold (Ct) method was used to calculate the relative target gene expression. Z-score Z score for each gene has been calculated in the single animals according to the formula Zscore = Xμ σ X represents the fold change of each animal while μ and σ represent the mean and the standard deviation of the No stress/Naïve group.
Z activation was then calculated by averaging the Z score of each gene in vHip, dHip, Amy, Pfc.
Z activation was then calculated by averaging the Z score of each gene in vHip, dHip, Amy, Pfc.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!