Abi 7500 quantitative pcr instrument

TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was utilized to extract total RNA from CRC cell lines and tissues, and SuperScript® III Reverse Transcriptase (Invitrogen) was used to synthesize cDNA based on the manufacturer’s protocol. Next, qRT-PCR was carried out in an ABI 7500 quantitative PCR instrument (TaKaRa, Dalian, China). The primer sequences for LATS2 and GAPDH are listed in Table S1. GAPDH was amplified for normalization. Relative LATS2 expression was calculated by the 2^−ΔΔCT method.

Total RNA was isolated from HUVECs using TRIzol reagent (Invitrogen, CA, USA) following the manufacturer’s instructions. 1 µg RNA was reversely transcribed into cDNA using a reverse transcription kit (Takara, Tokyo, Japan). Next, PCR reactions were performed on ABI 7500 quantitative PCR instrument using SYBR Master Mixture (Takara, Tokyo, Japan). The PCR conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 60 sec. The primers were as following: cathepsin C, forward: 5′- CCAACTGCACCTATCTTGACC −3′ and reverse: 5′- AAGGCAAACCACTTGTAGTCATT −3′; GAPDH, forward: 5′- GAAGGTGAAGGTCGGAGTC −3′ and reverse: 5′- GAAGATGGTGATGGGATTTC −3′. The relative expression of mRNA was normalized to GAPDH and calculated using 2^–ΔΔCt method.