Qscript cdna synthesis system

Normal human prostate RNA was obtained from Ambion (Austin, TX, USA) and Clontech (Palo Alto, CA, USA). Total RNA was prepared by PureLink™ RNA Mini Kit (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed using the qScript cDNA synthesis system (Quanta Biosciences, Gaithersburg, MD, USA). Real-time quantitative PCR (RT–qPCR) was performed with a LightCycler® 480 System (RochemDiagnostics, Basel, Switzerland) using SYBRGreen Master Mix (TaKaRa Bio, Otsu, Japan). Reactions used 50 ng of cDNA, were run in duplicate, and a mean value of the two samples calculated. Relative expression levels of each gene were quantified by the 2^−ΔCt method using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an endogenous control. A published nested PCR approach was used to verify the presence of the Δ133TP53 transcripts in control and clonal cells expressing Δ133TP53 isoforms^{15 (link)}. The primers used for RT–qPCR are shown in Supplementary Table S2 and primers for TP53 variants, GAPDH, CDKN1A, CXCR6, JAK2, IRF2, IL6ST, STAT6 are as previously described^{18 (link),34 (link),47 (link)}.

Normal brain RNA was obtained from Ambion (Austin, TX, USA) and Clontech (Palo Alto, CA, USA). Total cellular and tissue RNA was prepared by a PureLink™ RNA Mini Kit (Invitrogen, Carlsbad, CA, USA) and 1 μg of total RNA was reverse‐transcribed using the qScript cDNA synthesis system (Quanta Biosciences, Gaithersburg, MD, USA).
Real‐time qPCR was performed with a LightCycler® 480 System (RochemDiagnostics, Basel, Switzerland) using SYBR Green Master Mix (TaKaRa Bio, Otsu, Japan). Reactions used 50 ng of cDNA, were run in duplicate, and a mean value of the two samples was calculated. Relative expression levels of each gene were quantified by the 2^−ΔCt method using glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) as an endogenous control. The primers used for GAPDH were 5'‐GAAGGTGAAGGTCGGAGTC‐3' and 5'‐GAAGATGGTGATGGGATTTC‐3', and for CDKN1A they were 5'‐CTAATGGCGGGCTGCATCCA‐3' and 5'‐AGTGGTGTCTCGGTGACAAAGTC‐3', and TP53 variants as previously described 24. A published nested PCR approach was used to confirm the presence of the Δ133p53β transcript in 20 glioblastomas 5.