One-day-old mice were sacrificed in 75% ethanol, the brains removed to precooled Dulbecco’s modified Eagle medium (DMEM; KeyGEN, Nanjing, China) and the meninges and blood vessels removed. The cerebral cortex was then isolated, placed in new DMEM, cut into pieces and 2 mg/mL papainase (Sigma-Aldrich, St. Louis, MO, USA) added. The cortical tissue was then shaken on a shaker for 10 min at a constant temperature of 37 °C. After centrifugation at 1200 g for 5 min, the supernatant was removed and cells were resuspended and incubated in DMEM containing 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) at 37 °C. For neuronal isolation, the cells were resuspended in neurobasal medium (Gibco) after 4 h cultured, then the medium was changed every 2 days. For microglia isolation, the medium was changed every 3 days. After 14 days, microglial cultures were shaken on a shaker for 4 h at a constant temperature of 37 °C and the cells collected in 6-well plates (Corning, NY, USA) containing DMEM containing 10% FBS. Microglia were pretreated with the p38 MAPK inhibitor BIRB 796 (500 nM, Axon Medchem, Groningen, The Netherlands) for 6 h or the NLRP3 inhibitor glyburide (50 mM, Sigma-Aldrich) for 2 h, after which LPS (1 μg/mL, Sigma-Aldrich) was administered to activate microglial inflammation for 24 h.
Dulbecco s modified eagle medium dmem
Manufactured by Keygen Biotech
Sourced in China
Dulbecco's modified Eagle medium (DMEM) is a commonly used cell culture medium formulation that provides essential nutrients and growth factors for the in vitro cultivation of various cell types. It is a complex mixture of amino acids, vitamins, salts, and other components designed to support optimal cell growth and proliferation.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Glyburide, by Merck Group (1 mentions)
Papainase, by Merck Group (1 mentions)
Neurobasal medium, by Thermo Fisher Scientific (1 mentions)
Lipopolysaccharides (lps), by Merck Group (1 mentions)
Birb796, by Axon Medchem (1 mentions)
6 well plate, by Corning (1 mentions)
Sodium hydroxide (naoh), by Shanghai Lingfeng Chemical Reagent (1 mentions)
Anhydrous ethanol, by Shanghai Lingfeng Chemical Reagent (1 mentions)
Potassium permanganate, by Shanghai Lingfeng Chemical Reagent (1 mentions)
H2o2 assay kit, by Keygen Biotech (1 mentions)
Trypsin, by Keygen Biotech (1 mentions)
Hepg2, by Shanghai Institute of Biochemistry and Cell Biology (1 mentions)
Uplc grade acetonitrile, by Merck Group (1 mentions)
Ginsenoside rb1, by Chengdu Must Bio-Technology (1 mentions)
Ginsenoside rd, by Chengdu Must Bio-Technology (1 mentions)
Ginsenoside re, by Chengdu Must Bio-Technology (1 mentions)
Ginsenoside rf, by Chengdu Must Bio-Technology (1 mentions)
Ginsenoside rg1, by Chengdu Must Bio-Technology (1 mentions)
Notoginsenoside r1, by Chengdu Must Bio-Technology (1 mentions)
11 protocols using dulbecco s modified eagle medium dmem
1
Isolation and Activation of Microglia
2
Mercaptoacetic acid-based Anticancer Therapy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mercaptoacetic acid (AR), potassium permanganate (KMnO4, AR), cupric chloride (CuCl2·2H2O, AR), anhydrous ethanol (AR), monometallic sodium orthophosphate and sodium hydroxide (NaOH, AR) were obtained from Shanghai Lingfeng Chemical Reagent Co. Ltd. (Shanghai, China). Thioacetamide, poly(allylamine hydrochloride) (PAH, MW = 15 000–20 000), thiol-fluorescein polyethylene glycol isothiocyanate (SH-PEG-FITC) and polyethylene glycol (PEG, MW = 2000) were supplied from J&K Science (Beijing, China). SH-RGDGGGC was purchased from Bankpeptide (Hefei, China). Fetal bovine serum (FBS), 4′,6-diamidino-2-phenylindole (DAPI), Annexin V-FITC apoptosis staining/detection kit, LysoTracker Red DND-99 Kit, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), H2O2 assay kit, trypsin and Dulbecco's modified Eagle medium (DMEM) were purchased from KeyGEN BioTECH (Nanjing, China). Both the human liver hepatocellular carcinoma cells (HepG2) and human normal liver cells (L02) were obtained from the Shanghai Institute of Cell Biology (Shanghai, China). The nude mice (male, 4–6 weeks) were obtained from the Comparative Medicine Centre of Yangzhou University. Animal experiments were allowed by the Care Committee of Nanjing University (including guidelines for animal care & use, and guidelines for the euthanasia of mice, protocol #: 20170411-015).
3
Ginsenosides and Alzheimer's Disease Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
UPLC-grade acetonitrile was purchased from Merck (Darmstadt, Germany). Formic acid was purchased from Sigma-Aldrich (Mo, USA). Leucine enkephalin was obtained from Waters Corporation (Milford, MA, USA). Distilled water was obtained from Watson's Food & Beverage (Guangzhou, China).
The PC12 cells were purchased from Jiangsu KeyGEN BioTECH Corp., Ltd (Nanjing, China). Ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rb3, ginsenoside Rc, ginsenoside Rd, ginsenoside Re, ginsenoside Rf, ginsenoside Rg1, notoginsenoside R1, 20(S)-notoginsenoside R2, notoginsenoside Fa, gypenosides A, and gypenosides XLIX were purchased from Chengdu Must Bio-Technology Co., Ltd. (Chengdu, China). The 20(S)-ginsenoside Rb2, galantamine HBr, and berberine were purchased from the National Institutes for Food and Drug Control (Beijing, China). The structure of these compounds is shown inFigure 2 . Dulbecco's modified Eagle medium (DMEM) and phosphate buffer saline (PBS) were purchased from Jiangsu KeyGEN BioTECH Corp., Ltd. (Nanjing, China). Fetal bovine serum (FBS), trypsin, and dimethyl sulfoxide (DMSO) were purchased from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Amyloid β-protein fragment 25–35 was purchased from Sigma-Aldrich (St. Louis, MO, USA). YZG was produced by Guangxi Wanshoutang Pharmaceutical Co., Ltd., and formulated by water into suspension.
The PC12 cells were purchased from Jiangsu KeyGEN BioTECH Corp., Ltd (Nanjing, China). Ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rb3, ginsenoside Rc, ginsenoside Rd, ginsenoside Re, ginsenoside Rf, ginsenoside Rg1, notoginsenoside R1, 20(S)-notoginsenoside R2, notoginsenoside Fa, gypenosides A, and gypenosides XLIX were purchased from Chengdu Must Bio-Technology Co., Ltd. (Chengdu, China). The 20(S)-ginsenoside Rb2, galantamine HBr, and berberine were purchased from the National Institutes for Food and Drug Control (Beijing, China). The structure of these compounds is shown in
4
Synthesis and Characterization of Gold Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chloroauric acid (HAuCl4), cetyl trimethyl ammonium bromide (CTAB), sodium borohydride (NaBH4), silver nitrate (AgNO3), ascorbic acid, sodium hydroxide (NaOH) were purchased from Macklin Biochemical Technology Co., Ltd. (Shanghai, China). 1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC), cholesterol and TAX were purchased from Sigma-Aldrich (St Louis, MO, USA). Dulbecco's modified eagle medium (DMEM), calcein-AM, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT), propidiumiodide (PI) and annexin V-fluorescein isothiocyanate (FITC) were purchased from Jiangsu KeyGEN BioTECH Corp., Ltd. (Nanjing, China). Nude mice (female, 20 ± 2 g) were purchased from Animal Central Laboratory of Nanjing Medical University (Nanjing, China). All other chemicals were of analytical degree and purchased from Nanjing Chemical Reagent Co., Ltd. (Nanjing, China).
5
Caco-2 Cell Line Antioxidant Enzyme Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Caco-2 human intestinal cell line, Dulbecco’s modified Eagle medium (DMEM), penicillin–streptomycin, and trypsin-EDTA (0.25%) were purchased from Jiangsu KeyGen BioTech (Nanjing, China). Hank’s balanced salt solution (HBSS) and fetal bovine serum (FBS) were purchased from Gibco (NY, USA). CAT, GSH-PX, and GR antioxidant enzyme kits were purchased from Nanjing Jiancheng Bioengineering Institute. The primers for real-time PCR were synthesized by Genscript Biotechnology Co., Ltd. (Nanjing, China). Total RNA, and cDNA synthesis kits were purchased from Takara Bio. Inc. The peptide fraction of DLEE (98% purity) was synthesized by China Peptides Co. (Suzhou, China).
6
Near-IR Fluorescent Theranostic Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2-Methylimidazole (2-MI), Zn(NO3)2·6H2O, and ADM were purchased from Shanghai Aladdin Bio-Chem Technology Co., Ltd. (Shanghai, China). (1R,4R,7R, 10R)-a, aʹ, aʹʹ, aʹʹʹ -Tetramethyl-1, 4, 7, 10- tetraazacyclododecane-1,4,7,10-tetraacetic acid tetrasodium salt (DOTMA) was purchased from Guidechem (Zhejiang, China). Dulbecco’s Modified Eagle Medium (DMEM), Cell Counting Kit-8 (CCK-8), GelRed, and 4′, 6-Diamidino-2-phenylin-dole (DAPI) were obtained from Jiangsu KeyGEN BioTECH Co., Ltd. (Jiangsu, China). The Annexin V-FITC/7-AAD Apoptosis Detection Kit was purchased from Sino Biological (Beijing, China). DiR, a type of near-IR fluorescent cyanine lipophilic dye, was purchased from Biotium (CA, USA). Dbait and FAM-Dbait were synthesized by Nanjing Genscript Biotechnology Co., Ltd. (Jiangsu, China), and the sequence was: 5ʹ-GCT GTGCCCACAACCCAGCAAACAAGCCTAGA-(H)-TCTAGG CTTGTTTGCTGGGTTGTGGGCACAGC -3ʹ, where (H) is a hexaethylene glycol linker and the letters that are underlined and in bold are phosphorodiamidate nucleosides.
7
Fluorescent Imaging for Oncology Surgery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ICG was obtained from Yichang Pharmaceutical Co., Ltd. (Dandong, China). Female 4-week-old BALB/c nude mice were obtained from GemPharmatech Co., Ltd. (Nanjing, China). Phosphate-buffered saline (PBS), penicillin/streptomycin (pen/strep), and Dulbecco’s Modified Eagle Medium (DMEM) were obtained from KeyGEN BioTECH (Nanjing, China). Fetal bovine serum (FBS) was obtained from Zhejiang Tianhang Biotechnology (Huzhou, China). HSA was obtained from Gibco (Thermo Fisher Scientific, Waltham, MA, USA). FLI-10B was a diagnostic equipment suitable for open oncology surgery, provided by Nanjing Nuoyuan Medical Devices Co., Ltd. (Nanjing, China). Fluorescence spectrophotometer was RF-6000, purchased from SHIMADU (Shanghai, China). Ultraviolet visible near infrared spectrophotometer was UV-3600PLUS, purchased from SHIMADU (Shanghai, China).
8
Juglone Inhibits Macrophage Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dulbecco’s Modified Eagle Medium (DMEM) and Roswell Park Memorial Institute (RPMI) 1640 were purchased from KeyGEN BioTECH (Nanjing, China). Fetal bovine serum (FBS) was obtained from GIBCO (New York, NY, USA). Juglone (a inhibitor of Pin1), DMSO, and oil red O were purchased from Sigma-Aldrich (St. Louis, MO, USA). BAY11-7082 and oxLDL were obtained from Meilunbio (Dalian, China). Calcein-AM was purchased from YEASEN (Shanghai, China). The primary antibodies against VCAM-1 and F4/80 were obtained from Abcam (Cambridge, UK). Rabbit antibodies against MCP-1, ERK1/2, p-ERK1/2, JNK, p-JNK, p65, and p-p65 were purchased from Cell Signaling Technology (Beverly, MA, USA). Rabbit anti-Pin1 antibody was obtained from Proteintech (Chicago, IL, USA). HRP-conjugated antibody against β-actin was purchased from Kangchen Biotechnology (Shanghai, China).
9
Cultivation and Authentication of Lung Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human bronchial epithelial cell (HBE cells, cat. ZQ0001) and LUAD cell lines including A549 (cat. SCSP‐503), PC9 (cat. SCSP‐5085), H1299 (cat. SCSP‐589), SPC‐A1 (cat. ZQ0018), and H1975 cells (cat. SCSP‐597) were taken from the Chinese Academy of Sciences Cell Bank and authenticated using DNA fingerprinting, as well as being mycoplasma‐free. HBE, A549, H1299, and H1975 cells were cultured in RPMI‐1640 medium (Keygen Biotech) supplemented with 10% fetal bovine serum (FBS: Gibco). PC9 and SPC‐A1 were cultured with Dulbecco's modified Eagle medium (DMEM: Keygen Biotech) supplemented with 10% FBS. In a humidified 37°C incubator, cells were stored in a 5% CO2 environment. Guangzhou Biotech Corporation authenticated no mycoplasma was found in the cells.
10
Fiberglass-Reinforced Dental Resin Composite
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
High-strength fiberglass (diameter: 11 mm, Sinoma Technology Co., Ltd, China), resin matrix including bisphenol A-glycidyl methacrylate (Bis-GMA, AR, Sigma-Aldrich, City of Saint Louis, USA) and Methyl methacrylate (MMA; AR, Shanghai Titan Chemical Co., Ltd, China), a photoinitiator system including camphorquinone (CQ, Shanghai Chemical Technology Co., Ltd, China) and dimethylaminoethyl methacrylate (DMAEMA; AR, Shanghai Titan Chemical Co., Ltd, China), HCl (AR, Liyang Dongfang Chemical Reagent Co., Ltd, China), and 3-(trimethoxysilyl)propyl methacrylate (KH570, AR, Sigma-Aldrich, USA) were used without purification, chemically curing methyl methacrylate resin (New Century Dental, China), single bond universal (3M, America), dulbecco’s modified eagle medium (DMEM, KeyGEN BioTECH, China), Cell Counting Kit-8 (CCK-8; Beyotime Biotechnology Co., Ltd., Shanghai, China), LDH Assay Kit (Beyotime Biotechnology Co., Ltd., Shanghai, China), DCFH-DA (MedChemExpress, State of New Jersey, USA), Mouse IL-6 ELISA kit (Beyotime Biotechnology Co., Ltd., Shanghai, China), 4% paraformaldehyde (Biosharp, Anhui, China), phalloidine (APExBIO, Houston, USA), 4’,6-diamidino-2-phenylindole (DAPI; APExBIO, Houston, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!