Spleens were collected, crushed, homogenized and resuspended in RPMI 1640 containing 10% fetal calf serum, 2 mmol/l L-glutamine, 2-mercaptoethanol, penicillin and streptomycin. Cells (5.106 cells/mL) were cultured in presence of concanavalin A as a positive control (5 mg/ml), purified Der f1 (40 µg/ml) or medium alone for 72 h (n = 2–7 mice per group). Cytokines were assayed with bead-based Luminex® technology using the kit Pro Mouse Cytokine 23-plex designed for assessment of IL-4, Il-5, IL-10, IL-13, IL-17 and IFN-γ (Bio-Rad Laboratories, Munich, Germany). Assays were performed according to the manufacturer's specifications. Data analysis was performed using the Bio-Plex Manager Software version 4.0.
Ifn γ
Manufactured by Bio-Rad
Sourced in United States, Germany
IFN-γ is a protein that plays a crucial role in the immune system's response to infections and diseases. It is an important cytokine involved in the activation and regulation of various immune cells, including T cells and natural killer cells. IFN-γ is a valuable tool for researchers studying immune system function and disease pathogenesis.
Automatically generated - may contain errors
Lab products found in correlation
Tnf α, by Bio-Rad (12 mentions)
Gm csf, by Bio-Rad (10 mentions)
Il 10, by Bio-Rad (7 mentions)
G csf, by Bio-Rad (6 mentions)
Il 1β, by Bio-Rad (5 mentions)
Eotaxin, by Bio-Rad (5 mentions)
Interleukin 4 (il 4), by Bio-Rad (5 mentions)
Interleukin 6 (il 6), by Bio-Rad (5 mentions)
Mip 1α, by Bio-Rad (4 mentions)
Rantes, by Bio-Rad (4 mentions)
Mcp 1, by Bio-Rad (4 mentions)
Interleukin 2 (il 2), by Bio-Rad (4 mentions)
Ip 10, by Bio-Rad (3 mentions)
Il 17, by Bio-Rad (3 mentions)
Ifn λ1, by Thermo Fisher Scientific (2 mentions)
Il 1β, by Thermo Fisher Scientific (2 mentions)
Il 17a, by Thermo Fisher Scientific (2 mentions)
Il 23, by Thermo Fisher Scientific (2 mentions)
Ifn λ2, by Thermo Fisher Scientific (2 mentions)
Ifnλ3, by Thermo Fisher Scientific (2 mentions)
25 protocols using ifn γ
1
Cytokine Profiling of Splenocyte Responses
2
Quantitative PCR Analysis of Interferon Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR experiments were performed using iTaq™ Universal SYBR® Green Supermix (Qiagen, Hilden, Germany) as per the manufacturer’s instructions. Primers against IFNα (37 (link)) (Eurofins, Munich, Germany, custom DNA oligo forward: TCC ATG AGV TGA TBC AGC AGA, reverse: ATT TCT GCT CTG ACA ACC TCC C), IFNβ (Eurofins, Munich, Germany, custom DNA oligo forward: AAACTCATGAGCAGTGCA, reverse: AGGAGATCTTCAGTTTCGGAGG), IFNγ (Biorad, Munich, Germany, unique assay ID: qHsaCID0017614), IL-6 (Qiagen, Hilden, Germany Cat. 353458620), and OAS-2 (Qiagen, Hilden, Germany, Cat. 10025636) 96 h after IR were used. Comparative quantification method, ΔΔCt, was used to analyze relative gene expression patterns. The Ct values of a housekeeping gene, TBP1 (Qiagen, Hilden, Germany, Cat: QT00000721), were subtracted from those of target genes, resulting in ΔCt values. The ΔCt values for sham-irradiated samples were subtracted from those of irradiated samples, which provided a ΔΔCt value. Relative fold-change (n-fold) was calculated as 2-ΔΔCt, and averaged over four replicates to calculate the average n-fold change. A paired Student’s T-test was conducted using ΔCt values for sham- and 6 Gy irradiated samples.
3
Serum Cytokine Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For serum cytokine detection, blood samples were collected together with CRP and PCT samples at time points 0, 12, 24, 48, 72, and 96 h after study inclusion. The serum samples were kept at −75 °C until they were analyzed at the Virus Diagnostics Laboratory, University of Turku. Serum cytokine levels were determined by 27-plex immunoassay (IL-1β, IL-1rα, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12 (p70), IL-13, IL-15, IL-17, eotaxin, FGF basic, G-CSF, GM-CSF, IFN-γ, IP-10, MCP-1, MIP-1α, platelet-derived growth factor (PDGF-ββ), MIP-1, RANTES, TNF-α, vascular endothelial growth factor (VEGF)) from Bio-Rad Laboratories, Inc. (California, United States)). According to the manufacturer’s instructions, except that the amount of beads, detection antibodies, and streptavidin-phycoerythrin conjugate were used at 50% of their recommended concentration, which was tested previously as appropriate for the analysis system. The results were analyzed with Bio-Plex Manager 6.0 software. For statistical analyses and calculating the geometric mean cytokine levels, samples under the detection limit were given a value that was the detection limit divided by two. This was done in order to enable the inclusion of negative values (0 values) for geometric mean calculations.
4
Interictal Plasma Cytokine Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Interictal samples were collected at day 7 from the last seizure attack. The plasma was harvested within 30 min at 37 °C of venipuncture from EDTA-anticoagulated blood samples and stored at −80 °C for subsequent cytokine analysis. The concentrations of IL-2, IL-4, IL-6, IL-8, IL-10, IFNγ, GM-CSF, TNFα (Bio-Rad, USA), IL-17a (PeproTech, Rocky Hill, NJ, USA), IL-1β (Bender MedSystems, Vienna, Austria), IL1Ra (Cytoscreen, Biosource, Belgium), IFNλ1, IFNλ2, IFNλ3, IFNλ4 (eBioscience, CA, USA), and IL-23 (Invitrogen, Carlsbad, CA, USA) were measured by ELISA according to manufacturers’ instruction [16 (link)–20 (link)]. CSF concentrations of IL-6, IFNγ, IFNλ3 and IL-17a were measured using human cytoline/chemokine MILLIplex kits (Millipore Corp, Billerica, MA, USA) [21 (link)]. ELISAs were performed in duplicate.
5
Cytokine Profile Analysis in Plasma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were collected by venipuncture into EDTA-anticoagulation vials. Plasma was harvested from the collected samples within 30 min and stored at −80 °C for subsequent cytokine analysis. Concentrations of IL-2, IL-4, IL-6, IL-8, IL-10, IFNγ, GM-CSF, TNFα (all antibodies from Bio-Rad, USA), IL-17a (PeproTech, Rocky Hill, NJ, USA), IL-1β (Bender MedSystems, Vienna, Austria), IL1Ra (Cytoscreen, Biosource, Belgium), IFNλ1, IFNλ2, IFNλ3, IFNλ4 (eBioscience, CA, USA), and IL-23 (Invitrogen, Carlsbad, CA, USA) were measured by ELISA according to manufacturers’ instruction16 (link)22 (link)23 (link). ELISAs were performed in duplicate.
6
Cytokine Profiling of LPS-Stimulated Monocytes
7
Infection of Macrophages by Leishmania mexicana
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bone marrow-derived macrophages were differentiated for 7–9 days from the precursor cells of BALB/c mice in the presence of 20% L929 fibroblast cell culture supernatant as a source of macrophage-colony stimulating factor. Differentiated macrophages were cultivated in complete RPMI-1640 medium containing 10% FBS, 1 x PenStrep solution, 2 mM of L-glutamine (all from Sigma-Aldrich), and 50 μM of β-mercaptoethanol at 37°C with 5% CO2. To assess infection in macrophages, cells (5 x 104 per well) were plated on Lab-Tek chamber slides (ThermoFisher Scientific) and infected with WT or KO L. mexicana promastigotes freshly passaged through the mice, at a parasite to macrophage ratio of 5:1. Cells remained either unstimulated in complete RPMI 1640 medium or were stimulated 2 hours post infection (p.i.) with 50 U/ml of IFN-γ (Bio-Rad) and 500 ng/ml of LPS (Sigma-Aldrich). Slides were stained with Giemsa at 4 hours, 72 hours, and 6 days p.i. and the percent of infected macrophages and parasite load were counted from four biological replicates with two technical replicates each (400 cells per condition).
8
Real-Time PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA analyses were made as previously described (26 (link)). cDNA quantification for CD69 and IFNγ, (Bio-rad, CA, USA) was performed by using a real-time PCR (CFX96 connect, Bio-rad, CA, USA) and a SYBR Green PCR mix (Bio Rad), and all reactions were run in duplicate. The results are presented as the media of the relative expression units to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin reference genes calculated by the 2−ΔΔCt equation using the CFX manager 3.1 (Bio Rad). Reactions were performed according to the following thermal profile: initial denaturation (95°C, 15 min) followed by 40 cycles of 15 s at 95°C (denaturation) and 20 s at 60°C (annealing) and 20 s at 72°C (extension). Melting curve analysis was also analyzed for amplicon identification. Ct values of 35 or higher were excluded from the analyses.
9
Multiplex Cytokine Profiling in Serum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Serum cytokine levels were analyzed using single-plex sets for IL-1b, IL-2, IL-5, IL-4, IL-6, IL-8, IL-10, IL-12p40, GM-CSF, IFN-γ, CXCL10, and TNF-α (Bio-Rad, Hercules, CA, USA) following the manufacturer's instructions. Serum aliquots (50 μL) were used for analysis, with a minimum of 50 beads acquired per analyte. Median fluorescence intensities were measured using a Luminex 200 analyzer. Data collected was analyzed with MasterPlex CT control software and MasterPlex QT analysis software (Hitachi Software, San Bruno, CA, USA). Standard curves for each analyte were generated using standards provided by the manufacturer.
10
Comprehensive Cytokine and Macrophage Profiling
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!