The largest database of trusted experimental protocols

Tyrode s acid

Manufactured by Merck Group
Sourced in Germany

Tyrode's acid is a laboratory solution that is used to maintain the physiological pH and ionic composition of biological samples. It is commonly used in cell culture and tissue engineering applications. Tyrode's acid is a buffered solution that contains various salts, such as sodium chloride, potassium chloride, and calcium chloride, which help to maintain the appropriate osmotic pressure and ion balance for the cells or tissues being studied.

Automatically generated - may contain errors

6 protocols using tyrode s acid

1

Immunostaining and Microscopy of Mouse Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
CD1 and C57BL/6NCrl post-imaged embryos are rinsed with Tyrode’s acid (Sigma) 3 times and placed in holding and flushing media for 5 minutes to allow embryos to acclimate before 30-minute fixation in 4% paraformaldehyde on ice. Embryos were permeabilized using 0.2% Triton X-100 (Fisher). And then embryos were incubated with H2AXs139 (Genetex) at 1:1000 for 1 hour at room temperature. Embryos were rinsed in 1X PBT three times and then stained with AlexaFluor555 at 1:200. Embryos were rinsed in 1X PBS three times before processing for the Hoechst (Sigma) staining for 10 minutes to stain the DNA. Finally, embryos were rinsed and imaged in 1X PBS using 780 Zeiss microscope and Zen 2012 software.
+ Open protocol
+ Expand
2

Generation of Knockout Mice via ES Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mitomycin C, Genticin, Penicillin, Streptomycine, Neomycin, M16 and M2 media, Plasmid purification kit, Tyrodes acid and leukemia Inhibitory Factor were purchased from Sigma (Germany). PMSG (Folligon) and hCG (Chorulon) were purchased from MSD Animal Health (New Zealand). DMEM, FCS and trypsin was obtained from Gibco BRL (France). RNA and DNA extraction kits were bought from Intron (Korea). Endofree Plasmid Maxi Kit was purchased from Qiagene (USA). High Pure PCR Purification Kit was from Roche (Germany). EW and R1 embryonic stem cells and pEGFP-C1 were kindly donated by Dr. Karim Nayernia at Institute of Molecular Medicine and Cell Therapy, Düsseldorf, Germany and GENEOCELL, Canada.
To generate knockout mouse, ES cells were cultured and electroporated with the gene targeting vector. The genetically-modified cells were selected and transferred into embryos. The modified ES cells along with the cells of embryo were used to produce chimeric mice. Crosses between the chimeras and wild type mice were resulted heterozygous offspring.
+ Open protocol
+ Expand
3

Isolation of Eggshell-free Embryonic Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For C. elegans embryos, embryonic cells were isolated as described before (Edgar, 1995 (link); Park and Priess, 2003 (link)), with the following modifications. After cutting the adult worms in egg salt buffer, embryos were placed in the freshly made hypochlorite solution [75% Clorox (Clorox) and 2.5 N KOH] for 50 seconds. After washing with Shelton’s growth medium twice (Shelton and Bowerman, 1996 (link)), embryos were put into Shelton’s medium on the coverslip with metallic holds. Eggshell and permeabilization barrier were removed by repeated mouth pipetting with hand-drawn glass microcapillary tubes (10 microliters, Kimble Glass Inc.) to obtain eggshell and permeabilization barrier-free embryos. We call these embryos eggshell-free embryos for simplicity. For blastomere isolation, 2-cell stage eggshell-free embryos were further drawn to separate the two cells. ABx, ABxx, EMS and P2 cells were isolated by separating daughter cells after each cell division.
Two-cell stage mouse embryos were briefly placed in M2 medium containing Tyrode’s acid (Sigma-Aldrich) to remove the zona-pellucida. They were used as zona-free embryos or further separated by repeated mouth pipetting with hand-drawn glass microcapillary tubes to obtain individual blastomeres.
+ Open protocol
+ Expand
4

Quantitative Gene and Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total mRNA was isolated using TRIzol, reverse transcribed using Superscript III (Invitrogen), and analyzed using SYBR green PCR Master Mix (Applied Biosystems) coupled with 7900ht Fast RT-PCR system (Applied Biosystems). Human qRT-PCR primers were designed using Primer Blast (National Center for Biotechnology Information) and are described in Table S6. Proteins were extracted in PBS supplemented with 1% (vol/vol) Triton X-100, 1-mM EDTA, and protease inhibitor cocktail (Roche). E-cadherin protein was analyzed by Western blotting using rat anti–E-cadherin antibody (U3254; Sigma-Aldrich), anti–rat IgG-HRP secondary antibody (Jackson ImmunoResearch Laboratories, Inc.), and Western Lightning ECL kit (Thermo Fisher Scientific). E3.5 wild-type embryos were flushed in M2 medium (Sigma-Aldrich). Zona pellucida was removed with Tyrode’s acid (Sigma-Aldrich) and incubated for 10 min with anti–mouse antibody (Sigma-Aldrich) at 37°C and with guinea pig complement serum at 37°C for 30 min (Sigma-Aldrich). Three embryos or six resulting TE/ICMs were pooled together, and mRNA was isolated using TRIzol (Nishioka et al., 2009 (link)), reverse transcribed using Superscript VILO (Invitrogen), and analyzed using SYBR green PCR Master Mix. Mouse qRT-PCR primers (Table S7) were designed using Primer Blast.
+ Open protocol
+ Expand
5

CRISPR-Based Gene Editing in Mouse Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
C57BL/6J or C57BL/6J C3H/HeJ F1 mice were crossed to C57BL/6J stud males and pronuclear stage embryos were dissociated from cumulus cells using Hylorondase (Fisher, Cat # MR-0510F). After the zona was weakened with acid Tyrode’s (Sigma Aldrich, Cat # T1788), the embryos were subsequently washed in M2 buffer. Cas9 RNP complexes were then assembled in vitro by combining 40uM of Cas9 protein with 2ug of sgRNAs targeting Klf5 (CCAGACCGUCCAUGCCCACG, AGCACCCGCGUGGGCAUGGA, GGUC AGCACCCGCGUGGGCA, Synthego). Assembled RNPs were then mixed with a cohort of 50–75 embryos, and electroporated with standard parameters (Modzelewski et al., 2018 (link)). Electroporated embryos were then cultured in KSOM until E3.5, at which point they were processed for IF analysis described above.
+ Open protocol
+ Expand
6

CRISPR-Based Gene Editing in Mouse Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
C57BL/6J or C57BL/6J C3H/HeJ F1 mice were crossed to C57BL/6J stud males and pronuclear stage embryos were dissociated from cumulus cells using Hylorondase (Fisher, Cat # MR-0510F). After the zona was weakened with acid Tyrode’s (Sigma Aldrich, Cat # T1788), the embryos were subsequently washed in M2 buffer. Cas9 RNP complexes were then assembled in vitro by combining 40uM of Cas9 protein with 2ug of sgRNAs targeting Klf5 (CCAGACCGUCCAUGCCCACG, AGCACCCGCGUGGGCAUGGA, GGUC AGCACCCGCGUGGGCA, Synthego). Assembled RNPs were then mixed with a cohort of 50–75 embryos, and electroporated with standard parameters (Modzelewski et al., 2018 (link)). Electroporated embryos were then cultured in KSOM until E3.5, at which point they were processed for IF analysis described above.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!