Anti p65 antibody

Chromatin immunoprecipitation (ChIP) assay was carried out using EZ‐ChIP kit (Millipore, Watford, UK) according to the manufacturer's protocol. Cells were treated with JQ1 (1 µmol/L) for 3 h and formaldehyde (1% final concentration) was added to fix the protein–DNA complexes. Cells were sonicated to shear the DNA into 100–1000 bp fragments. Immunoprecipitation was carried out overnight with an anti‐p65 antibody (5 µg, Santa Cruz Biotechnology, Santa Cruz, CA, USA). NF‐kB p65 binding to the IL8 and IL6 promoter was quantified by real‐time qPCR, using SYBR Green on a Rotor‐Gene 6000 (Corbett Research). The fold change was calculated as (2^{−(Ct(input)−Ct(ChIP))}) compared with the IgG negative control. Primer pairs of IL6 and IL8 were as follows: IL6, forward, 5′‐AGCACTGGCAGCACAAGGCAAAC‐3′ and IL6, reverse, 5′‐CAAGCCTGGG‐ATTATGAAGAAGG‐3′; and IL8, forward, 5′‐GGGCCATCAGTTGCAAATC‐3′ and IL8, reverse, 5′‐TTCCTTCCGGTGGTTTCTTC‐3′.

Postconfluent HUVECs cultured on fibronectin-coated glass coverslips were treated with 50 ng/mL PO for 30 min prior to stimulation with 5 ng/mL IL-1ß. At the indicated timepoints, cells were fixed for 15 min with 4% paraformaldehyde (Sigma, #158127), permeabilized for 30 min with 0.1% Triton X-100 (Sigma, #93443), washed with PBS and finally blocked for one hour with 3% BSA-TBS-T. For immunostaining, rabbit polyclonal anti-p65 antibody (Santa Cruz, #sc-372) was used (1:500) with a secondary antibody, Alexa-Fluor 488-conjugated goat anti-rabbit IgG (Invitrogen, #A32723) at 1:1000. Cells were counterstained for 15 min with Alexa Fluor 568 phalloidin (Invitrogen, # A12380 1:1000) and 5 min with 4′,6-Diamidino-2-phenylindole (DAPI, Life Technologies, Carlsbad, CA, USA, #62247; 1:10000). Samples were examined with an Olympus IX71 microscope with a 20x/0.75 UPlanSApo objective. Images were processed with Image J software.

SW620 cells were cultured for 24 hours and were untreated, treated with BV6 (5μM), treated with TNFα (100 U/ml), or treated with BV6 and TNFα for one hour. Cells were fixed with 4% paraformaldehyde for 30 minutes, rinsed with PBS, blocked for one hour, and incubated with anti-p65 antibody (Santa Cruz) for one hour. The cells were then washed three times with PBS and incubated with a Cy5-conjugated anti-rabbit IgG for one hour. The cells were washed four times with PBS and followed by incubation with HOECHST for 5 minutes. The cells were analyzed by confocal microscopy.

Cells were seeded on 8-well chamber slides (EMS, Hatfield, PA) and after treatment, were briefly rinsed in PBS and fixed with 2% paraformaldehyde for 20 min at room temperature, followed by permeabilization in ice-cold acetone (10 min at −20°C) and 1% Triton-X100 (20 min at room temperature). Cells were incubated in a humidified chamber overnight with anti-p65 antibody (Santa Cruz Biotechnology, Dallas, TX, Cat no. SC-372) at 4°C, followed by ALEXA-Fluor 488 tagged secondary antibody (Life Technologies, Carlsbad, CA) and were visualized under a fluorescence microscope. Quantitation of fluorescent signals in nucleus and cytoplasm were performed using GIMP 2.8 software (www.gimp.org).

For quantitation of nuclear content of NF-κB, nuclei were isolated using the Panomics Nuclear Extraction Kit and protein was measured using the Transbinding TM NF-κB Assay Kit according to the manufacturer’s instructions. Alternatively, astrocytes were cultured on two-well chamber slides, fixed with 4% formaldehyde, permeabilized with 0.1% Triton X-100 and after blocking nonspecific binding with 1% bovine serum albumin, stained with anti-p65 antibody (1:100; Santa Cruz Biotechnology, Santa Cruz, CA) overnight at 4 °C. Cells were then rinsed three times for 5 min each in PBS and incubated with Alexa488-conjugated anti-rabbit IgG (Thermo Fisher Scientific) for 1 h at room temperature. After three rinses for 5 min each in PBS, cells were mounted in Vectashield fluorescence mounting medium containing 4.6-diamidino-2-phenylindole (Vector Laboratories, Burlingame, CA). Images were taken with a Confocal Laser Scanning Microscope LSM Multiphoton 510 (Zeiss, Thornwood, NY).