Total RNA, isolated from control‐ and hormone‐treated peanut samples was treated with RNase free DNase1 (Sigma‐Aldrich, Carlsbad, CA, USA) to eliminate any DNA contamination and was reverse transcribed with oligo‐dT primer using SMART™ MMLV Reverse Transcriptase (Clontech, Becton Dickinson, Palo Alto, CA, USA). cDNA samples were diluted fivefold and 0.5 μL of the diluted reaction mixture was taken as qRT‐PCR template in a 20 μL total reaction volume containing 0.4 μm gene specific primers with10 μL SYBR Premix Ex Taq with ROX (Takara Bio Inc., Kusatsu, Shiga, Japan) and the samples were appraised in three technical replicates. PCR analysis was carried out in Realplex amplifier (Eppendorf, Hamburg, Germany) with the following cycle parameters: 95 °C for 5 min; 40 cycle of 95 °C for 20 s, 58 °C for 20 s, 72 °C for 20 s followed by melting curve. Gene specific primers were designed from 3′ UTR of AdZADH2 (Table S1). Polyubiquitin (UBI1) and alcohol dehydrogenase III (ADH3) were used as internal controls for calculating relative quantification of gene expression 25 , 26 . Relative fold change in RNA expression was estimated using ΔΔCT method 24 .
Sybr premix ex taq with rox
Manufactured by Takara Bio
Sourced in Japan
SYBR Premix Ex Taq with ROX is a ready-to-use master mix for real-time PCR applications. It contains SYBR Green I dye, DNA polymerase, dNTPs, and ROX reference dye.
Automatically generated - may contain errors
Lab products found in correlation
Smart mmlv reverse transcriptase, by Takara Bio (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Rnase free dnase 1, by Merck Group (1 mentions)
Dnase treatment and removal kit, by Thermo Fisher Scientific (1 mentions)
Q7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis kit, by Thermo Fisher Scientific (1 mentions)
Q5 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Quantstudio 5 system, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
5 protocols using sybr premix ex taq with rox
1
Quantitative RT-PCR Analysis of Peanut RNA
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from dissected tissues or cultured cells using Trizol reagent (Invitrogen, 15596-018), according to the manufacturer’s instructions. RNA was further purified by DNAse treatment and removal kit (Ambion, AM1906). Equal amount of total RNA was subjected to reverse transcription using SuperScript III First-Strand Synthesis kit (Invitrogen, 18080-051) as instructed. Real-time PCR was performed on a 7500 or Q7 real-time PCR system (Applied Biosystems) by using SYBR Premix Ex Taq with ROX (Takara, RR820B). For real-time PCR, primers used for gene expression are listed below: Dmp1, GGTGATTTGGCTGGGTC, TGTGGTCACTATTTGCCTGT; Gapdh, CCTCGTCCCGTAGACAAAATG, TCTCCACTTTGCCACTGCAA, Aqp4, TTTGGACCCGCAGTTAT, AAGGCGACGTTTGAGC;
The mRNA expression level was normalized to housekeeping gene GAPDH. Results are shown as mean ± SEM.
The mRNA expression level was normalized to housekeeping gene GAPDH. Results are shown as mean ± SEM.
3
RNA Extraction and Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells or dissected tissues using Trizol reagent (Invitrogen). Equal amount of total RNA was subjected to reverse transcription using PrimeScript™ RT reagent Kit with gDNA Eraser (Takara) as instructed. Real-time PCR was performed on a Q5 real-time PCR system (Applied Biosystems) by using SYBR Premix EX Taq with ROX (Takara). Amplification results were normalized on the basis of the GAPDH mRNA levels in each sample. For real-time PCR, primers used for gene expression were listed in Supplementary Table S1 .
4
Quantifying Transcriptional Changes in Leaf Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from leaf samples (subjected to various treatments) according to Chang et al., [56 (link)]. Two microgram of total RNA was used for first-strand cDNA synthesis by an oligo dT (18 mer) primer using SMART MMLV Reverse Transcriptase (Clontech, Becton Dickinson, USA). Diluted first strand cDNA samples were subjected to qRT-PCR with gene-specific primers for AdLEA (Table A in S1 File ) and 10 μl SYBR® Premix Ex Taq with ROX (Takara Bio Inc., Japan). Three independent biological replicates with three technical replicates of each biological replicate for each sample were used for analysis including three non-templates, which served as negative control (non-template control with just water without cDNA). qRT-PCR was carried out in Realplex (Eppendorf, Germany) amplifier with the following program: 95°C for 5 min; 40 cycles of 95°C for 15 s, 58°C for 20 s, 72°C for 30 s followed by the melting curve to ensure a single product of each amplicon. Alcohol dehydrogenase class III (adh3) and polyubiquitin (UBI1) were used as internal controls to calculate relative quantification of gene expression [57 (link)]. The threshold cycle (CT) was used to calculate relative fold change (RFC) in RNA expression at each time point of the treated sample compared to control conditions by using the formula, fold change = 2-(ΔCt treated-ΔCt control) [58 (link)].
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by using RNAiso Plus reagent (TaKaRa, Shiga, Japan). The purified RNA was assessed by Nanodrop 2000 (Thermo Scientific, Waltham, MA, USA) to check the quality and quantity. PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Japan) and 1 μg of RNA was used to synthesize complementary DNA (cDNA). SYBR Premix EX Taq with ROX (TaKaRa, Japan) was used for performing the real-time PCR on a QuantStudio™ 5 System (Applied Biosystems, Waltham, MA, USA). The mRNA levels of target genes were normalized on the basis of GAPDH mRNA levels in each sample. The 2-ΔΔCT method was used to calculate gene expression. All primer sequences used in the experiment are listed in Supplementary Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!