For siRNA knockdown, BV‐2 cells were transfected with predesigned Silencer select siRNAs (Thermo Fisher Scientific) targeting mouse KDM6B or scrambled control using Lipofectamine 2000 CD (Invitrogen, Carlsbad, CA, USA). After 24 hours, transfected cells were treated with 10‐ng/mL LPS or vehicle (PBS) and then collected for RNA isolation. Overexpression of KDM6B in BV‐2 cells was achieved using a plasmid (OriGene, Rockville, MD, USA) and Lipofectamine 2000 CD (Invitrogen, Carlsbad, CA, USA). KDM6B knockout cell lines were generated using CRISPR/Cas9 expression plasmids (GeneScript U3789CF280_1,2,3). Three plasmids were tested, each expressing a puromycin resistance gene, Cas9, and unique guide RNA pairs (gRNAs: TCTCATGGCAGTAGCTCCGG; TCACGGGAAGTTGGAATCCC; TGGAGGAAGCTTCGCCGAGC) designed to eliminate KDM6B coding sequence by conferring sequence‐specific exonuclease activity. Following transfection, BV‐2 cells were selected using puromycin, and surviving colonies were manually picked and expanded. Clonal cell lines were propagated and analyzed for KDM6B gene editing using polymerase chain reaction (PCR) with primers (forward: TCTAGGATTGGAGGGAAATTGG; reverse: AAAGTACGGCCAAGGACA) within gRNA seed sequences.
Lipofectamine 2000 cd
Manufactured by Thermo Fisher Scientific
Sourced in United States
Lipofectamine 2000 CD is a transfection reagent developed by Thermo Fisher Scientific for the efficient delivery of DNA, RNA, and other nucleic acids into a variety of cell types. It is a cationic lipid-based formulation designed to facilitate the uptake of genetic material into the target cells.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine ltx, by Thermo Fisher Scientific (6 mentions)
Dneasy blood tissue kit, by Qiagen (3 mentions)
Opti mem medium, by Thermo Fisher Scientific (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Dmem f12 medium, by Thermo Fisher Scientific (1 mentions)
1640 medium, by Thermo Fisher Scientific (1 mentions)
Silencer select sirna, by Thermo Fisher Scientific (1 mentions)
Immobilon p pvdf membrane, by Merck Group (1 mentions)
Benchmark pre stained protein ladder, by Thermo Fisher Scientific (1 mentions)
Sds protein gel loading solution, by Quality Biological (1 mentions)
Tris glycine acrylamide gel, by Thermo Fisher Scientific (1 mentions)
Opti mem 1 reduced serum media, by Thermo Fisher Scientific (1 mentions)
Phrg tk, by Promega (1 mentions)
Infinite m200 luminometer, by Tecan (1 mentions)
Sigmaplot v11, by Grafiti LLC (1 mentions)
Dual luciferase reporter assay kit, by Promega (1 mentions)
Fortessa flow cytometer, by BD (1 mentions)
γh2ax antibody, by BD (1 mentions)
Puromycin, by InvivoGen (1 mentions)
Dmem with high glucose and l glutamine, by Thermo Fisher Scientific (1 mentions)
25 protocols using lipofectamine 2000 cd
1
Modulating KDM6B Expression in BV-2 Cells
2
Generating Stable Cell Lines via Transient Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transient assays to generate stable cells lines, the following transfection protocol was carried out: the parental CHO-K1 cells were incubated at 300,000 cells/mL in 500 μL of DMEM-F12 medium (Gibco, USA) supplemented with 10% FBS and 100 mM L-glutamine at 37 °C and 5% (v/v) CO2. When reaching 80 to 90% of confluence, the cells were transfected; for this purpose, the culture medium was removed and a mixture containing 500 ng of expression vector was added with 20 μL of Lipofectamine 2000 CD (Invitrogen, USA) in 100 μL of OptiMEM medium (Invitrogen, USA), and cells were incubated for 4 h at 37 °C and 5% CO2. Next, the transfection mixture was removed, cells were fed with 500 μL of DMEM-F12 medium supplemented with 10% FBS and then cells were incubated for 48 h at 37 °C and 5% CO2.
3
HeLa Cell Transient Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells were obtained from the American Type Culture Collection and were cultured in 1640 medium (Gibco, Life technology, USA) supplemented with 10% fetal bovine serum (Hyclone, Thermo Scientific, USA) in a humidified incubator in 5% CO2 at 37 °C. For transfection of pcDNA and pcDNA3/NS3DEN3, 1 × 105 HeLa cells were seeded on each well of 24-well plate. After culturing for 24 h or adherent HeLa cells reached approximately 70% confluency, cells were transiently transfected under optimized transfection conditions. Briefly, 0.8 μg of plasmid DNA was diluted in 50 μL of OptiPro™SFM, and mixed with 2.0 μL of Lipofectamine® 2000 CD (Lipofectamine, Invitrogen, USA) in 50 μL of OptiPro™SFM and incubated for 20 min at room temperature. The mixture was then added to the cells, and incubated at 37 °C in a humidified atmosphere and 5% CO2 for further 72 h.
4
Transient and Stable Transfection of GC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In transient transfection, GC cells were plated into six-well or twenty-four-well plates. Lipofectamine LTX (Invitrogen) and Lipofectamine 2000 CD (Invitrogen) were used to transfect the plasmids or shRNAs. After 48 hours, the functional assays were performed. For retroviral transduction, the GC cells were plated into six-well plates for 24 hours and the confluency was about 50%. A mixture of retroviruses and hexadimethrine bromide (Polybrene; 5 μg/mL) were used to infect the GC cells, and puromycin with a concentration of 2 μg/mL was used to select stable populations.
5
Immunoblot Analysis of PyE140 Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
293-ORF6 [21 (link)] cells in 60 mm dishes were infected with HuAd5 null, HuAd5-PyE140na, or HuAd5-PyE140co at a multiplicity of infection (MOI) of either 500 or 6,500 pu/cell or transfected with 8 μg of DNA-PyE140na using lipofectamine 2000CD (Invitrogen). Cell lysates were harvested in SDS protein gel loading solution (Quality Biological Inc., Gaithersburg, MD) 24 hours or 48 hours post-infection/transfection, run on a 4–20% Tris-Glycine acrylamide gel (Invitrogen) and transferred to an Immobilon-P PVDF membrane (Millipore Corp., Bedford, MA). The primary antibody was a 1:100 dilution of sera from mice immunized with DNA-PyE140na and HuAd5-PyE140na. The secondary antibody was a 1:2,500 dilution of polyclonal goat anti-mouse IgG + IgM conjugated to alkaline phosphatase (Applied Biosystems Inc., Foster City, CA). The marker is BenchMark Prestained Protein Ladder (Invitrogen). Proteins were visualized with an alkaline phosphatase Western-Light Chemiluminescent Detection System (Tropix Inc., Bedford, MA) and an alkaline phosphatase colorimetric substrate (KPL Inc., Gaithersburg, MD).
6
Transfection of Pancreatic Cancer Cells
7
Dual Luciferase Assay for Transcriptional Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 24–48 h of incubation with siRNA treatments, C2C12 cells were washed and covered with Opti-MEM I Reduced Serum Media (Invitrogen). Cells were co-transfected with 1 μg of one endo-free DNA construct described in previous sections and 20 ng of Renilla vector, ph-RG-TK (Promega), using Opti-MEM I Reduced Serum Media and lipofectamine 2000 CD (Invitrogen). Cells were incubated for 24 h and luciferase activity was measured using the Dual Luciferase Reporter Assay Kit (Promega) and an Infinite M200 Luminometer (Tecan). Activity was expressed as relative luciferase units, the ratio of firefly luciferase activity to Renilla luciferase activity. Triplicates within an experiment were averaged. The experimental unit was defined as the experiment, with N = 4 experiments. Relative luciferase units were transformed (logX +1) to reduce heterogeneity of variance. Transformed data were analyzed in SigmaPlot v. 11.0 (Systat Software, Inc.) by two-way ANOVA. The statistical model included the main effects of siRNA treatment and DNA construct and the two-way interaction. Differences were considered significant at P<0.05. The Holm-Sidak method was used as a post-hoc test to evaluate all pairwise comparisons. Non-transformed data are shown graphically.
8
Transient Transfection of PDA Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfection of plasmids and siRNAs into PDA cells was performed using the transfection reagents Lipofectamine LTX and Lipofectamine 2000 CD (Invitrogen), respectively. For transient transfection, cells were transfected with plasmids or siRNAs at different doses as indicated for 48 hr before the performance of functional assays. PDA cells treated with a transfection reagent alone were included as mock controls.
9
γH2AX Profiling of BE4max and seBE Constructs
10
Transient Transfection of PDAC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transient transfection, cells were transfected with plasmids or shRNA for 48 h before functional assays using Lipofectamine LTX and Lipofectamine 2000 CD (Invitrogen), respectively. PDAC Cells transfected with control plasmids or shRNA using Lipofectamine LTX and Lipofectamine 2000 CD were defined as controls. PDAC cells treated with the transfection reagents alone were included as mock controls.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!