The largest database of trusted experimental protocols

Miscript mirna mimic

Manufactured by Qiagen
Sourced in Germany, United States

The MiScript miRNA Mimic is a laboratory tool designed for the study of microRNA (miRNA) function. It provides a synthetic miRNA molecule that can be used to simulate the effects of a specific miRNA in experimental settings. The MiScript miRNA Mimic is intended to facilitate the investigation of miRNA-mediated gene regulation and cellular processes.

Automatically generated - may contain errors

40 protocols using miscript mirna mimic

1

Validation of miRNA-binding sites in Drosophila

Check if the same lab product or an alternative is used in the 5 most similar protocols
In vitro target validation was performed using Drosophila S2 cells (Invitrogen). The cells were kept in Schneider Drosophila medium supplemented with 10% heat-inactivated FBS (Gibco) and 1% Penicillin Streptomycin (vol/vol) (Thermo Fisher Scientific) at 25 °C. Three luciferase constructs were examined: (1) a positive control containing three sites reverse complementary to miR-276 with four nucleotide linkers between each miR-276 binding site; (2) A. gambiae BCAT 3′UTR and (3) A. gambiae BCAT 3′UTR with a scrambled miR-276 binding site. All constructs were separately inserted into the multiple cloning region located downstream of the Renilla translational stop codon within the psiCheck-2 vector (Promega). psiCheck-2 reporters (100 ng) and a synthetic A. gambiae miR-276-5p miScript miRNA Mimic (100 ng, Qiagen) at a final concentration of 100 nm were co-transfected into Drosophila S2 cells using FuGENE HD transfection reagent (Promega). Cells transfected only with psiCheck-2 reporters were used as a “no miRNA mimic” control. Dual Luciferase Reporter Assay was performed 48 h post transfection using the Dual Luciferase Reporter Assay System (Promega). Firefly luciferase in the psiCheck-2 vector was used for normalization of the Renilla luciferase expression. Measurements were made in triplicates, and transfections were repeated three times independently.
+ Open protocol
+ Expand
2

Modulation of miR-21 in Head and Neck Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
MicroRNA-21 mimic (miScript miRNA Mimic, Qiagen) or miR-21 inhibitor (Antihsa-miR-21-5p; Qiagen) (Supplementary Table S1) were diluted to a final concentration of 5 nM in serum-free culture medium, including HiPerFect® Transfection Reagent (3μL/well) (Qiagen), according to the manufacturers’ instructions, and incubated for 10 min at room temperature. Cells (NCI and FaDu) were mixed with transfected complexes, seeded at 1.5 × 105 cells/well of 24-well plates and incubated for 24 h under normal growth conditions (at 37 °C and 5% CO2). The next day, the media were removed and replaced with experimental media of 1 μM or 2 μM NNK. Untreated control groups were grown in serum-free basal media, in parallel to experimental groups. After 24 h, media were removed, the cells were washed once with PBS and total protein was isolated using M-PER reagent (mammalian protein extraction reagent; Thermo Scientific).
Assays were carried out according to the manufacturer’s instructions and performed in triplicate. All experiments were independently repeated three times.
+ Open protocol
+ Expand
3

Adipocyte Differentiation and miR-21 Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 3T3-L1 cell line (ATCC-CL-173) was cultured in DMEM/F12/10% fetal calf serum (FCS) at 37°C, 95% humidity, and 5% CO2 (n = 6). Differentiation of 3T3-L1 into adipocytes was induced by incubation in DMEM/F12/10% FCS supplemented with 0.5 mM isobutylmethylxanthine, 1 μM dexamethasone, and 1.67 μM insulin for 48 h and then in DMEM/F12/10% FCS supplemented with 1.67 μM insulin for 5 days. 7 days after adipogenic induction, the adipocytes were incubated with 5 nM miR-21 mimic (Syn-mmu-miR-21-5p miScript miRNA Mimic, MSY0000530; QIAGEN) or control mimic (AllStars Negative [Neg.] Control siRNA [small interfering RNA], 5 nmol, 1027289; QIAGEN) for 48 h. DharmaFECT Transfection Reagent was used to transfect cells.
+ Open protocol
+ Expand
4

Transfection of miRNA and siRNA in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Selected miRNA mimics and miRNA inhibitors (‘antagomirs’) were obtained from miScript miRNA Mimic and miScript miRNA Inhibitor, respectively (Qiagen, France) and are listed in supplementary Table S2. The siRNA used for inhibiting BRCA1 gene expression (siBRCA1) was synthesized by Thermo Scientific, Dharmacon (M-003,461–02–0005, siGENOME SMART pool, Human BRCA1 (672), 5 nmol). Cells were seeded at a density of 300,000 cells per well in 6-well plates. Twenty-four hours later, miRNAs and siRNAs were transfected using Lipofectamine 2000 reagent (Invitrogen, CA, USA) following the manufacturer’s instructions. As a mock control, cells were transfected with transfection reagent alone (Tmock). Three days after transfection, the cells were washed with PBS and recovered for further analysis.
+ Open protocol
+ Expand
5

Regulation of MHC I Promoter by miR-17/20a

Check if the same lab product or an alternative is used in the 5 most similar protocols
5×104 CT26 cells were seeded into individual wells of a 24-well plate, cultured overnight, and then transfected with Renilla luciferase constructs together with different doses of 20 μM miRNA mimics (miScript miRNA Mimic, Qiagen, Chatsworth, CA, USA) for mmu-miR-17 and/or mmu-miR-20a mimics using Lipofectamine 2000 (Invitrogen). After 24 hours of incubation, Renilla luciferase activities were evaluated using the Dual-Luciferase Reporter Assay system (Cat#1910, Promega, Madison, WI, USA). For MHC I promoter reporter assay, 5×104 CT26 cells, miR-Ctrl or miR-17~92 cells were seeded into individual wells of a 24-well plate, cultured overnight, and then transfected with MHC I promoter reporters, pGL3-B250 or pGL3-β2m, or together with plasmids encoding pre-miR-17/20a or/and Mekk2, or together with plasmids encoding shMekk2 or/and Mekk2 using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After 24 hours of incubation, luciferase activities were evaluated using the Luciferase Reporter Assay system (Cat#E1500, Promega, Madison, WI, USA).
+ Open protocol
+ Expand
6

N2a Cell Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse neuroblastoma (N2a) cells were obtained from American Type Culture Collection (ATCC) and cultured in Dulbecco’s modified eagle medium (DMEM) with 10% fetal bovine serum. Approximately 300,000 cells from three different passage number stocks were simultaneously platted in 6-well culture plates. Cells were treated with miScript miRNA mimic (Qiagen) and a negative control siRNA with no known targets in mammalian genome (All Stars Negative siRNA, Qiagen) at 60 nM for 48 hours. Transfections were carried out using lipid-based HiPerfect transfection reagent (Qiagen). Cells were harvested 48 hours after transfection and total RNA was isolated using standardized Trizol protocol.
+ Open protocol
+ Expand
7

Overexpression of miR-129-5p in Neuroblastoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ectopic expression of miR-129-5p in SHSY5Y cells was verified by quantitative real-time PCR (Supplementary Fig. 2). SH-SY5Y cells were seeded at 4.5 ×105 cells per well in a 6-well plate. After 24 h, the cells were transfected with either Allstars Negative Control (ANC; Qiagen, Hilden, Germany) or the miR-129-5p miScript miRNA Mimic (MIMAT0000242, sequence: 5′CUUUUUGCGGUCUGGGCUUGC3′; Qiagen, Hilden, Germany) using HiPerFect Transfection Reagent (Qiagen, Hilden, Germany). After an additional 48 h, the cells were lysed using QiAzol Lysis Reagent (Qiagen, Hilden, Germany). Total RNA was isolated using miRNeasy Mini Kit following the manufacturer’s protocol (Qiagen, Hilden, Germany). Total RNA (150 ng) was reverse transcribed using miScript II RT Kit (Qiagen, Hilden, Germany). qPCR was performed using the miScript Primer Assay (Qiagen, Hilden, Germany) with primers specific for miR-129-5p via the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, United States). RNU6B (Qiagen, Hilden, Germany) served as an endogenous control. The statistical significance of differences among three independent replicates was calculated by Student’s t test in GraphPad Prism 9.
+ Open protocol
+ Expand
8

Modulating miR-194 Activity in Canine PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR-194 activity was altered in PBMCs of dogs using transfection of chemically-modified double-stranded RNA that mimics or inhibts microRNA with HiPerfect Transfection Reagent (QIAGEN, USA). Following the manufacturer’s recommendations, PBMCs at 1.6 x105 were transfected with All Stars Negative control siRNA (5 nM), miR-194 control transfection (Scrambled), miR-194 mimic (5 nM) (Mimic), or miR-194 inhibitor (50 nM) (Inhibitor) (miScript miRNA Mimic and Inhibitor Qiagen, USA). For the evaluation of the transfection rate, siRNA AllStars HS Cell Death Control (50nM) (Qiagen, USA) was used, and cell death was analyzed using light microscopy after staining with trypan blue according to the manufacturer’s recommendations. Transfected cells were placed in culture in 24-well plates with complete RPMI medium at 37°C in a 5% CO2 incubator. After 48 hours, the cells and supernatants were collected to evaluate transfection rate, cell viability, and evaluation of targets of miR-194. Mean transfection rates were 20% in the control group and 22% in the infected group.
+ Open protocol
+ Expand
9

Modulating miR-29a in Osteoblast Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Synthetic miR-29a sense (miScriptmiRNA Mimic) and antisense (miScriptmiRNA inhibitor) oligonucleotides and scramble controls were obtained from Qiagen (Qiagen, Valencia, CA). Primary calvarial OB precursor cells were incubated overnight and transfected with 100–200 nM miR-29a sense and antisense oligonucleotides or the scramble control by Lipofectamine 2000.
+ Open protocol
+ Expand
10

miRNA Mimics Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The miRNA mimics (miScript miRNA Mimic, QIAGEN, Germany), miRNA-124 (miR-124, MIMAT0000422), miRNA-128 (miR-128, MIMAT0000424), miRNA-let-7c (miR-let-7c, MIMAT0000064), miRNA-34a (MIMAT0000255), and miRNA-negative control (miR-NC, cat# 1027180), were used in this study.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!