Vaccinia capping enzyme
The Vaccinia Capping Enzyme is a recombinant enzyme that catalyzes the addition of a guanine nucleotide cap structure to the 5' end of mRNA transcripts. This enzyme is derived from the vaccinia virus and plays a crucial role in the viral mRNA capping process.
Lab products found in correlation
18 protocols using vaccinia capping enzyme
Identifying ACP1 mRNA-binding proteins
In vitro Transcription and RNA Capping
In vitro transcription was preformed using synthetic oligonucleotides containing the T7 RNA polymerase promoter and the 5′ UTR of pT7-FLuc-A50 by the method originally described by (17 (link)) with modifications described in (18 (link)). The sequence of the transcribed RNA was: 5′ – GGGAAUUCACCGGUACUACUGUCAGCGCUAGC – 3′. Transcribed RNAs were PAGE purified overnight, ethanol precipitated and resuspened in H2O. RNAs were capped using vaccinia capping enzyme (New England Biolabs) according to manufactures instructions. 5 pmol of capped, radiolabelled RNA was incubated with 5 μl of rabbit reticulocyte lysate (Promega) and 100 pmol of indicated tiRNAs. Reactions were incubated on ice for 10 min and then crosslinked in Stratolinker (1.6 J). Crosslinked complexes were denatured in SDS-loading dye and heated to 100°C for 10 min before running on 4–20% Novex gel. Gels were dried and complexes were visualized by autoradiography.
Engineered p27 Encoding Plasmids for Optimized mRNA Expression
Example 2
A Flag tagged p27 encoding plasmids can be engineered to facilitate in vitro transcription of p27 encoding mRNA (
To reduce innate immune responses and toxicity and at the same time maximize the efficiency and duration of expression of the mRNA encoding p27 described in
Engineered p27 Encoding mRNA Protocol
Example 2
A Flag tagged p27 encoding plasmids can be engineered to facilitate in vitro transcription of p27 encoding mRNA (
To reduce innate immune responses and toxicity and at the same time maximize the efficiency and duration of expression of the mRNA encoding p27 described in
Amplified Template Preparation for in vitro Transcription
Capping of E. coli RNA
Synthesis and Purification of mRNA for In Vitro Translation
DNA templates were amplified from a plasmid containing the corresponding 5’ UTR and the NanoLuc Luciferase coding sequence. Primers used for this amplification added a 30T sequence at the 3′ end to form a poly(A) tail after transcription. The HBB 5’ UTR containing mRNA was then capped using Vaccinia Capping enzyme (New England Biolabs) and 2′O-methylated using Vaccinia 2′O Methyltransferase (New England Biolabs). The IRES-containing mRNAs were uncapped and polyadenylated.
In Vitro RNA Capping and Labeling
Synthesis and Purification of Modified mRNA
Synthesis of Luciferase and EPO mRNAs
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!