Log In Sign up
The largest database of trusted experimental protocols

Pcr 2.1 topo vectors

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The PCR 2.1-TOPO vectors are a set of plasmid vectors designed for the direct cloning of Taq polymerase-amplified PCR products. They provide a quick and efficient method for the insertion of PCR fragments into a plasmid vector.

Automatically generated - may contain errors

Lab products found in correlation

Dig 11 utp, by Roche (1 mentions) M sssi, by New England Biolabs (1 mentions) Hpaii, by New England Biolabs (1 mentions) Ez dna methylation kit, by Zymo Research (1 mentions) Accuprime dna polymerase, by Thermo Fisher Scientific (1 mentions) Q5 dna polymerase, by Thermo Fisher Scientific (1 mentions) Superscript 3, by Thermo Fisher Scientific (1 mentions) Rneasy plus mini kit, by Qiagen (1 mentions) Dynabeads mrna direct kit, by Thermo Fisher Scientific (1 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Taq polymerase, by Thermo Fisher Scientific (1 mentions) Gel extraction kit, by Qiagen (1 mentions) Dh5 alpha competent cells, by New England Biolabs (1 mentions) Pgl4.10 luc2 vector, by Promega (1 mentions) Abi prism bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

PCR Topo II vector PCR-TOPO vector TOPO II vector TOPO vector PCR TOPO 2.1

9 protocols using pcr 2.1 topo vectors

1

Viroid Transcript Cloning and Probe Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Viroid transcripts of 302 ~ 372 nt containing positive monomeric full-length sequences of CEVd or HSVd were cloned into pcr2.1-TOPO vectors (Invitrogen, Life technologies, Carlsbad, CA, USA) as templates to allow generation of complimentary-strand probes (CEVd-p; HSV-p). In vitro transcription with T7 polymerase and DIG-modified UTP (DIG-11-UTP) was performed following the manufacturer’s protocol (Roche, Basel, Switzerland). The transcripts (20 μL) were diluted with nuclease-free water and then purified by centrifugation with phenol/chloroform. The purified transcripts were precipitated by addition of 1/10 volume of 3 M sodium citrate (pH5.2), 1/100 volume of glycogen and 3 volume of 100 % ethanol followed by centrifugation at 17,000 g for 15 min. The pellets were resuspended in 5 μL of nuclease-free water. Normally 1 μg of viroid-contained plasmid could generate approximately 3–5 μg of DIG-labeled RNA probe in our study. DIG-labeled probes were stored at −80 °C.
Lin C.Y., Wu M.L., Shen T.L, & Hung T.H. (2015). A mutual titer-enhancing relationship and similar localization patterns between Citrus exocortis viroid and Hop stunt viroid co-infecting two citrus cultivars. Virology Journal, 12, 142.
+ Open protocol
+ Expand
2

Methylation Analysis of ERBB2 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
The −499ERBB2-pCpGL reporter plasmid was methylated using the CpG methyltransferases M.SssI or HpaII (New England Biolabs, Massachusetts, USA). The extent of methylation was determined by bisulfite sequencing PCR. Briefly, plasmid DNA was bisulfite converted using the EZ DNA Methylation Kit (Zymo Research). A 513 bp region of the −499ERBB2-pCpGL reporter plasmid containing the CpG sites of interest was amplified by PCR with the following primers: ERBB2methf: 5′-GGAGGGGGCAGAGTTATTAGTTTTT-3′; ERBB2methr: 5′-AAACCTTTCTTAATATTCTTAACATCCTC-3′. PCR product were cloned into pCR 2.1- TOPO vectors (Invitrogen, Carlsbad, CA), and DNA methylation was verified by DNA sequencing.
Quiñones-Lombraña A., Blair R.H, & Blanco J.G. (2017). Investigation of the Role of DNA Methylation in the Expression of ERBB2 in Human Myocardium. Gene, 628, 286-294.
+ Open protocol
+ Expand
3

Cloning and Sequencing of Bovine OAS Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
bOAS1, bOAS2, and bOAS3 cDNAs were cloned from RoNi/7 cells. Briefly, the cells were treated with 1,000 U of IFN-α overnight, and total cellular RNA was extracted using an RNeasy Plus Mini kit (Qiagen). cDNA was synthesized by reverse transcription using SuperScript III (Invitrogen) and mRNA-specific reverse primers. bOAS1-rev and bOAS2-rev (Table 1) primers were used for reverse transcription to synthesize bOAS1 and bOAS2 cDNA, respectively. Three cDNA fragments were cloned to assemble the full length of the bOAS3 open reading frame. bOAS3-F1-rev, bOAS3-F2-rev, and bOAS3-F3-rev (Table 1) were used for reverse transcription reactions to synthesize three cDNA fragments (bOAS3-F1, bOAS3-F2, and bOAS3-F3, respectively). The DNA fragments of bOAS1, bOAS2, bOAS3-F2, and bOAS3-F3 were amplified by using AccuPrime DNA polymerase (Invitrogen) with the forward primers and reverse primers (see Table S1 in the supplemental material), and were cloned into pCR2.1 TOPO vectors (Invitrogen). The DNA fragment of bOAS3-F1 was amplified by using Q5 DNA polymerase (NEB) and was cloned into pCR II Blunt-TOPO vectors (Invitrogen). The cloned DNAs were sequenced and analyzed. The OAS1 sequence matched the predicted mRNA sequence in GenBank (ID 107513273).
Li Y., Dong B., Wei Z., Silverman R.H, & Weiss S.R. (2019). Activation of RNase L in Egyptian Rousette Bat-Derived RoNi/7 Cells Is Dependent Primarily on OAS3 and Independent of MAVS Signaling. mBio, 10(6), e02414-19.
+ Open protocol
+ Expand
4

Antibody Variable Region Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols
Messenger RNA from clones that went through limited dilution cloning was isolated using the Dynabeads mRNA Direct Kit (cat# 61012; Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized by reverse transcriptase polymerase chain reaction (PCR), using SuperScript III Reverse Transcriptase (cat# 18080044; Invitrogen), and cDNAs were used as templates to amplify antibody-variable VL and VH regions. PCR was performed with high-fidelity Taq polymerase (cat# 11304011; Invitrogen) and the Novagen Mouse Ig Primer Set (cat# 69831–3; VWR, Radnor, PA), which included 6 VH and 7 VL primer sets. Amplified VL and VH PCR products were purified and cloned into pCR 2.1 Topo vectors (cat# K450002; Invitrogen), and colonies containing VH or VL inserts were picked for PCR amplification and sequenced.
Varkey R., Du Q., Karnell J.L., Xiao X., Casey K.A., Woods R., Rosenthal K., Wilson S., Dall’Acqua W.F., Wu H., Herbst R., Ettinger R, & Damschroder M. (2019). Discovery and characterization of potent IL-21 neutralizing antibodies via a novel alternating antigen immunization and humanization strategy. PLoS ONE, 14(1), e0211236.
+ Open protocol
+ Expand
5

Cloning Hamster ACSL4 Coding Sequence

Check if the same lab product or an alternative is used in the 5 most similar protocols
To clone the hamster ACSL4 complete coding sequence, as previously described for hamster ACSL3 cloning [34 (link)], we first compared mRNA sequence from human, mouse and rat ACSL4 gene and selected highly conserved regions across these species for primer sets design. Using primers identified by this approach, hamster ACSL4 coding region was amplified from a hamster liver cDNA library, cloned into pCR2.1-Topo vectors (Invitrogen, Carlsbad, CA, USA) and sequenced. The primers are listed in Supplemental Table 1. The hamster ACSL4 coding region was subcloned into pcDNA4.0-HisMax-TOPO vector, resulting in the plasmid pHis-HamACSL4 for hamster ACSL4 expression in mammalian cells. Recently, the genomic sequence of a female golden Syrian hamster (Mesocricetus auratus) became available on NCBI. The NCBI reference sequence (XP_005082531.1) predicted ACSL4X5 protein sequence differs from our ACSL4 protein sequence at amino acid position 311 with a proline substituted by serine.
Kan C.F., Singh A.B., Dong B., Shende V.R, & Liu J. (2015). PPARδ activation induces hepatic long-chain acyl-CoA synthetase 4 expression in vivo and in vitro. Biochimica et biophysica acta, 1851(5), 577-587.
+ Open protocol
+ Expand
6

Targeted siRNA knockdown of DDX26B and RBMX2 in HEK293T cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA targeting human DDX26B and RBMX2 were purchased as ON-TARGETplus SMARTpools (Dharmacon/Thermo Scientific Bio, Pittsburgh, PA). ON-TARGETplus Non-Targeting siRNA #1 (D-001810-01-05) was used as a negative control. 140 pmol of siRNA was transfected into HEK293T cells using Lipofectamine 2000 for a period of 72 hours, after which RNA was harvested using Trizol.
cDNA was synthesized and RT-PCR was performed using primers C5 RT-F/RT-R and FBXW12 RT-F/RT-R (IDT, Supplemental Table 8). The targeted amplicons for C5 and FBXW12 spanned exons 4–21 and exons 4–10, respectively. Products were run on a 1.5% agarose gel, and bands indicating the molecular weight of the full-length isoform was excised. The remaining gel products were extracted using the Gel-Extraction kit (Qiagen) and re-amplified using the same primers. The final products were analyzed on a 2% agarose gel. Differentially expressed products were gel-extracted and TOPO cloned into PCR2.1-TOPO vectors (Invitrogen/Life Technologies). Products were identified by Sanger sequencing (Quintara Biosciences) using M13 Forward and M13 Reverse primers and matched to the genome using BLAT (60 ).
Chen J., Hackett C.S., Zhang S., Song Y.K., Bell R.J., Molinaro A.M., Quigley D.A., Balmain A., Song J.S., Costello J.F., Gustafson W.C., Dyke T.V., Kwok P.Y., Khan J, & Weiss W.A. (2015). The genetics of splicing in neuroblastoma. Cancer discovery, 5(4), 380-395.
+ Open protocol
+ Expand
7

Promoter-Luciferase Cassette Construction for SbaP Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
To evaluate the promoting activity and regulatory element of SbaP, a promoter-luciferase cassette was constructed. All primers used to amplify specific fragments by PCR method are listed in Table 2. PCR products were ligated into pCR2.1-TOPO vectors (Invitrogen, NY, USA) and then subcloned into the Sac I/Bgl II site of pGL4.10 [Luc2] vector (Promega, CA, USA). The serial-deleted fragments of SbaP were constructed using the restriction enzymes listed in Table 3. The plasmid pGL-SbaP was digested by specific enzymes, blunted end by DNA polymerase I, Large (Klenow) Fragment, self-ligated using T4 ligase and then transformed into DH5-alpha competent cells (NEB, MA, USA).
Shi Y., Soderlund M., Xiang J, & Lu Y. (2015). Function and Regulation Domains of a Newly Isolated Putative β-Actin Promoter from Pacific White Shrimp. PLoS ONE, 10(4), e0122262.
+ Open protocol
+ Expand
8

Detecting Mutations in DNA Gyrase and Topoisomerase IV

Check if the same lab product or an alternative is used in the 5 most similar protocols
In order to detect mutations within the QRDR in 2 subunits of both DNA gyrase (gyrA and gyrB) and topoisomerase IV (parC and parE), polymerase chain reaction (PCR) and sequencing analysis were performed using the specific primer pairs summarized in Table 2. Briefly, after amplification of the QRDR by PCR, the PCR products were cloned into pCR 2.1-TOPO vectors (Invitrogen, USA) and introduced into Escherichia coli DH5α cells. Sequencing analysis of the QRDR from purified plasmids of competent cells was performed by using ABI PRISM BigDye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, USA).
Yamanaka H., Kadomatsu R., Takagi T., Ohsawa M., Yamamoto N., Kubo N., Takemoto T, & Ohsawa K. (2019). Antimicrobial resistance profiles of vancomycin-resistant Enterococcus species isolated from laboratory mice. Journal of Veterinary Science, 20(2), e13.
+ Open protocol
+ Expand
9

Genotyping Leishmania braziliensis Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols
L. braziliensis isolated from the ATL patients were genotyped according to the nucleic acid sequence of a segment with approximately 400 base-pairs, starting at position 425,451 on parasite’s chromosome 28 (i.e. locus CHR28/425451), as previously described(Queiroz et al., 2012 (link)). Briefly, the locus CHR28/425451 was amplified from genomic DNA of L. braziliensis cultured from each ATL subject, using primers 5':TAAGGTGAACAAGAAGAATC and 5':CTGCTCGCTTGCTTTC. Amplicons were electrophoresed, and their bands extracted from agarose gels then cloned into pCR 2.1-TOPO vectors (Invitrogen Inc.), according to manufacturer’s instructions. Plasmid mini-preps were generated from four representative bacterial clones, for each L. braziliensis isolate (Sambrook et al., 1989 ). Plasmid inserts were sequenced with primers complementary to bacteriophage M13 sequences flanking the vector’s cloning site. Sequencing employed Sanger’s method at Macrogen Inc. (Seoul, S. Korea). The consensus sequence and haplotypes of SNP and indel polymorphisms (i.e. alleles) at the CHR28/425451 locus were determined across the different L. braziliensis in the sample with the Mega 4.0 software package (Tamura et al., 2007 (link)).
Silva S.C., Guimarães L.H., Silva J.A., Magalhães V., Medina L., Queiroz A., Machado P.R, & Schriefer A. (2017). Molecular epidemiology and in vitro evidence suggest that Leishmania braziliensis strain helps determine antimony response among American tegumenary leishmaniasis patients. Acta tropica, 178, 34-39.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!