Superscript 4 cdna synthesis kit

First-strand cDNAs were synthesized from 1 μg of total RNA using the SuperScript IV cDNA synthesis kit (Thermo Scientific). The cDNA products were diluted to 50 μL. PCR amplification (50 μL) was performed using 2.5 μL of cDNA as template with attB-flanked gene-specific primers (Additional file 7: Table S5) in a Veriti Thermo Cycler (Thermo Fisher Scientific) using Phusion polymerase master mix (Thermo Fisher Scientific). Cycling parameters were as follows: an initial denaturing step at 94 °C for 5 min, 35 cycles at 96 °C for 15 s, 55 °C for 30 s, 72 °C for 1 min followed by a final extension step at 72 °C for 10 min. Specific PCR products were cloned into the pDONR221 vector (Thermo Fisher Scientific) in the presence of BP clonase (Invitrogen). Plasmid DNAs were isolated according to standard protocols and recombinant plasmids were subjected to sequencing using universal M13 primers and the BigDye terminator cycle sequencing kit v1.1 (Thermo Fisher Scientific). Sequencing products were EDTA/ethanol-precipitated, dissolved in formamide, and loaded for analysis on an in-house capillary 3130xl Genetic analyzer (Applied Biosystems).

RNA was isolated using InnuPrep RNA kit (Analytik Jena, Jena, Germany) and cDNA was generated using SuperScript IV cDNA Synthesis Kit (ThermoFisher Scientific). For qPCR, Eva Green Dye (Solis Biodyne, Tartu, Estonia) was used and respective primer pairs; p50 (fw: 5′-CACTTAGCAATCATCCACCTT-3′, rev: 5′-AGCCCTCAGCAAATCCT-3′), p65 (Qiagen; QT02324308), c-Rel (Qiagen; QT00052472), p52 (fw: 5′-GGGGCATCAAACCTGAAGATTTCT-3′, rev: 5′-TCCGGAACACAATGGCATACTGT-3′), RelB (Qiagen QT00038640), CTGF (fw: 5′-CTCGCGGCTTACCGACTG-3′, rev: 5′-GGCTCTGCTTCTCTAGCCTG-3′), PAI-1 (SERPINE-1) (fw: 5′-CTCTCTCTGCCCTCACCAAC-3′, rev: 5′-GTGGAGAGGCTCTTGGTCTG-3′) αSMA (fw: 5′-CGTGGGTGACGAAGCACAG-3′, rev: 5′-GGTGGGATGCTCTTCAGGG-3′), collagen IAI (fw: 5′-GCTCCTGCTCCTCTTAGCG-3′, rev 5′-CCGTTCTGTACGCAGGTGAT-3′), RNA-polymerase IIA (fw: 5′-GGAGATTGAGTCCAAGTTCA-3′, rev: 5′-GCAGACACACCAGCATAGT-3′), integrin αv (fw: 5′-CACTTCGGCGATGGCTTTTC-3′, rev: 5′-GTAGCAGGAGTCCCGAGAGA-3′), integrin α2 (fw: 5′-GTGGCTTTCCTGAGAACCGA-3′, rev: 5′-GATCAAGCCGAGGCTCATGT-3′), integrin β1 (fw: 5′-ACGCCGCGCGGAAAAGATGA-3′, rev: 5′-GCACCACCCACAATTTGGCCC-3′), Data analysis was performed using QuantStudio5 and QuantStudio Design and Analysis Software (ThermoFisher Scientific).

Total RNA from mouse tissues was isolated using the Qiagen AllPrep DNA/RNA purification kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. In brief, 10–20 mg of each tissue was homogenized as previously described [47 (link)] in RLT buffer supplemented with 1% β-mercaptoethanol. After RNA isolation, DNA digestion was performed by incubating 350 ng of RNA per sample with 2.5% DNase and 10% RDD buffer (QIAGEN, Hilden, Germany) for 30 min at room temperature. Reverse transcription was performed using the SuperScript IV cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA). Gene expression was quantified using the SensiMix™ II Probe Master mix (Bioline, London, UK) on a StepOnePlus™ Real-Time PCR System (Applied Biosystems™, Thermo Fisher Scientific, Waltham, MA, USA) with primers, as listed in Supplemental Table S1.
The qPCR results were expressed as mean HEV-ORF3 vector genome copy number per µg total RNA (vg/µg). Known copy numbers of the HEV p6 plasmid were serially diluted and used to generate a standard curve.

After total RNA harvest, cDNA was prepared using Superscript IV cDNA synthesis kit (Thermo Fisher).³² Real‐time PCR was performed using a QuantStudio 6 Flex (Applied Biosystems, Foster City, CA, USA). Primer sequences are listed below.

Primer name	Forward	Reverse
VILLIN 1	ATGACTCCAGCTGCCTTCTCT	GCTCTGGGTTAGAGCTGTAAG
LGR5	ACCCGCCAGTCTCCTACATC	GCATCTAGGCGCAGGGATTG
LYZ2	GGAATGGATGGCTACCGTGG	GGAATGGATGGCTACCGTGG
CHGA	CTCGTCCACTCTTTCCGCAC	CTGGGTTTGGACAGCGAGTC
MUC2	ATGCCCACCTCCTCAAAGAC	GTAGTTTCCGTTGGAACAGTGAA
OLFM4	CAGCCACTTTCCAATTTCACTG	GCTGGACATACTCCTTCACCTTA
KRT20	TTCAGTCGTCAAAGTTTTCACCG	TCCTATACAGCGAGCCACTCA
FABP2	GTGGAAAGTAGACCGGAACGA	CCATCCTGTGTGATTGTCAGTT
MUC1	GGCATTCGGGCTCCTTTCTT	TGGAGTGGTAGTCGATGCTAAG
CLDN18	ACATGCTGGTGACTAACTTCTG	AAATGTGTACCTGGTCTGAACAG

Total RNA was isolated from the small intestine tissue or mouse small intestinal organoids using Trizol reagent (Invitrogen, Carlsbad, CA, USA), and reverse-transcribed using the iScript^TM cDNA Synthesis kit (BioRad, Hercules, CA, USA). The resulting cDNA was subjected to qPCR using the StepOnePlus^TM Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with AccuPower® 2X Greenstar qPCR Master Mix (Bioneer, Daejeon, Rep. of Korea), according to the manufacturer’s protocol. Relative gene expression levels were analyzed using the 2(^-ΔΔCt) method and normalized relative to 18 S rRNA expression.
The gene expression analysis in the human intestinal organoids was conducted as follows: total RNA was prepared from human intestinal organoids (hIOs) using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA), and cDNA was synthesized using the Superscript IV cDNA Synthesis Kit (Thermo Fisher Scientific). qPCR analysis was performed using a 7500 Fast Real-time PCR system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. Relative gene expression levels were analyzed using the 2(^-ΔΔCt) method and normalized relative to GAPDH expression. The primer sequences used in the experiments are listed in Supplementary Table 7.

etv2 mRNA was synthesized as previously described^{5 (link)}. To analyze expression of muscle markers, approximately 75 pg of zebrafish etv2 mRNA was injected into fli1a:GFP embryos at the 1-cell stage. Embryos were screened for ectopic GFP expression at the 10-somite stage and then frozen for qPCR analysis. Groups of 10 embryos were analyzed in two independent experiments. An RNAqueous 4-PCR kit (ThermoFisher) was used to extract RNA. cDNA synthesis was performed using Superscript IV cDNA synthesis kit (ThermoFisher). Quantitative real-time PCR was performed using SYBR Green Master Mix (ThermoFisher) and StepOne Software v2.3 (Applied Biosystems). The following primers were used:
ef1α (TCACCCTGGGAGTGAAACAGC) and (ACTTGCAGGCGATGTGAGCAG),
myf5 (GGTTGACTGCAACAGTCCTG) and (GCGTTGGCCTGAGGCATCTT),
myog (GCATAACGGGAACAGAGGCA) and (CAGCCTTCCTGACTGCCTTA),
myod (CCAGCATCGTGGTGGAGCGAATT) and (GGTCGGATTCGCCTTTTTCT).
The results were analyzed using StepOne Software v2.3 (Applied Biosystems). Two biological and two technical replicates were obtained for each sample (four biological replicates were available for control uninjected embryos). Relative expression values were normalized for ef1α expression. Statistical analysis was performed using Prism 8 software (GraphPad Software).