Rabbit anti myc

Manufactured by Cell Signaling Technology

Sourced in United States

Rabbit anti-Myc is a primary antibody that specifically binds to the Myc protein. It is commonly used in western blotting, immunoprecipitation, and other applications to detect and study the Myc protein.

Automatically generated - may contain errors

Lab products found in correlation

38 protocols using rabbit anti myc

Comprehensive Protein Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used for immunoblotting: rabbit anti-SNRP70 (Abcam, #ab83306), rabbit anti-GAPDH (Santa Cruz, #sc-25778), rabbit anti-MYC (Cell Signaling, #13987), rabbit anti-p21 (Cell Signaling, #2947), rabbit anti-CDC20 (Cell Signaling, #14866), rabbit anti-FLAG (Cell Signaling, #14793), rabbit anti-CDC45 (Cell Signaling, #11881), rabbit anti-MAX (Novus, #NBP1-49963), mouse anti-Cyclin A2 (Santa Cruz, #sc-596), and mouse anti-β-actin (Sigma, #A5441). The following antibodies were used for co-immunoprecipitation (Co-IP), RNA immunoprecipitation (RIP) and chromatin immunoprecipitation (ChIP) analysis: rabbit anti-MYC (Santa Cruz, #sc-789), rabbit anti-MAX (Santa Cruz, #sc-764), rabbit anti-MYC (Cell Signaling, #9402), and normal rabbit IgG (Cell Signaling, #2729) as a negative control, and anti-FLAG M2 affinity gel (Sigma, #A2220).

Wang Z., Yang B., Zhang M., Guo W., Wu Z., Wang Y., Jia L., Li S., Xie W, & Yang D. (2018). LncRNA epigenetic landscape analysis identifies EPIC1 as an oncogenic lncRNA that interacts with MYC and promotes cell cycle progression in cancer. Cancer cell, 33(4), 706-720.e9.

+ Open protocol

+ Expand

Antibody Acquisition and Usage

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were obtained from Sigma-Aldrich. Primary antibodies were obtained
as follows; anti-FLAG (M2; Sigma) (mouse), anti-Myc (rabbit) (Cell Signaling),
and anti-HA (rat) (Roche Applied Science). All secondary antibodies were
obtained from Roche Applied Science.

Malik S., Jang W, & Kim C. (2017). Protein Interaction Mapping of Translational Regulators Affecting Expression of the Critical Stem Cell Factor Nos. Development & Reproduction, 21(4), 449-456.

+ Open protocol

+ Expand

Immunoprecipitation Using Commercial Antibodies

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were obtained from Sigma–Aldrich. Primary antibodies were obtained as follows; anti-FLAG (M2; Sigma) (mouse), anti-Myc (rabbit) (Cell Signaling), and anti-HA (rat) (Roche Applied Science). All secondary antibodies were obtained from Roche Applied Science.

Malik S., Jang W., Park S.Y., Kim J.Y., Kwon K.S, & Kim C. (2019). The target specificity of the RNA binding protein Pumilio is determined by distinct co-factors. Bioscience Reports, 39(6), BSR20190099.

+ Open protocol

+ Expand

Codon-Optimized HPV-31 E2 and PV Replication Assay

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Codon optimized FLAG HPV-31 E2 (DeSmet et al., 2016 (link)) and the ori-luciferase plasmids for the PV transient replication assay (Fradet-Turcotte et al., 2010 (link)) were used as previously reported (DeSmet et al., 2016 (link)). FGFR-1, 2, and 4 constructs were provided by L. Thompson (UC Irvine). A Myc tag was added to the C terminus of FGFRs by PCR amplification using the following Primers Bam-FGFR1-F: GATCGGATCCATGTGGAGCT, FGFR1-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGCGGCGTTT, Bam-FGFR2-F: GATCGGATCCATGGTCAGCT, FGFR2-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCTGTTTTAACACTG, Bam-FGFR3-F: GATCGGATCCATGGGCGCCCCT, FGFR3-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCCGTCCGCGA, Kpn-FGFR4-F: GATCGGTACCATGCGGCTGC, FGFR4-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCTGTCTGCAC, and inserted into pcDNA3. The following antibodies were used: mouse anti-FLAG M2, phospho-Tyrosine specific PY-99 (Santa Cruz) and PY-100 (Cell Signaling), rabbit anti-MYC (Cell Signaling), anti-FGFR1 (Abcam), anti-FGFR2 (Santa Cruz), and anti-FGFR4 (Santa Cruz). BPV-1 E2 was identified with B201, a mouse monoclonal antibody with an epitope between amino acids (aa) 160–220 (Breiding et al., 1996 (link)). Mouse-anti HPV-16-E2 (TVG-261) and HPV-16 E2 sheep-antiserum (Siddiqa et al., 2015 (link)) were used to identify HPV E2 proteins.

DeSmet M., Kanginakudru S., Jose L., Xie F., Gilson T, & Androphy E.J. (2018). PAPILLOMAVIRUS E2 PROTEIN IS REGULATED BY SPECIFIC FIBROBLAST GROWTH FACTOR RECEPTORS. Virology, 521, 62-68.

+ Open protocol

+ Expand

Immunofluorescence Assay for Malaria Parasite

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

IFAs were performed as described [48 (link)]. Briefly, parasites were washed twice with PBS and dried as a thin film on 10-well slides. Cells were fixed in 100% acetone for 30 minutes at room temperature. Antibodies were diluted in PBS/3%BSA and incubated for 1 hour, followed by 5 washes in PBS. Secondary antibodies were applied for 1 hour in PBS/3%BSA containing 1 μg/ml DAPI followed by 5 washes with PBS. Mounting medium (Dako) was added and the slide sealed with a coverslip for imaging. Dilutions of primary antibodies were: mouse anti-GFP 1:500 (Roche), rabbit anti-GFP (Thermo) 1:500, rabbit anti-KAHRP 1:500 (a kind gift of Prof. Brian Cooke), mouse anti-MSRP6 1:250 [7 (link)], rabbit anti-myc 1:500 (Cell Signaling Technologies), mouse anti-REX2 1:250 [45 (link)], rabbit anti MAHRP2 1:250 [[49 (link)], a kind gift of Prof. Hans-Peter Beck], rabbit anti-REX1 1:2000 (newly raised) and rat anti HA 1:500 (Roche). Secondary antibodies used were donkey anti-rabbit conjugated with Alexa Fluor-488, -594 or goat anti-rabbit conjugated with Alexa-647 and goat anti-mouse conjugated with Alexa Fluor-488, -594 or donkey anti mouse conjugated with Alexa-647 (Invitrogen) diluted 1:2000.

Mesén-Ramírez P., Reinsch F., Blancke Soares A., Bergmann B., Ullrich A.K., Tenzer S, & Spielmann T. (2016). Stable Translocation Intermediates Jam Global Protein Export in Plasmodium falciparum Parasites and Link the PTEX Component EXP2 with Translocation Activity. PLoS Pathogens, 12(5), e1005618.

+ Open protocol

+ Expand

Comprehensive Cellular Immunophenotyping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were fixed for 10 min with Cytofix/Cytoperm (BD Biosciences, San Jose, CA, USA) at 4 °C. The overall expression of MYC, IKZF1, IRF4, and H3K27me3 was evaluated by incubating 10⁵ cells with 5 μLof an alexa 647-conjugated mouse anti-H3K27me3 antibody (Cell Signaling, Danvers, MA, USA, 12158S), alexa 647-conjugated mouse anti-EZH2 antibody (BD Biosciences, 563491) PE-conjugated mouse anti-IKZF1 (BD Biosciences, 564476), rat anti-IRF4 (Biolegend, 646403), rabbit anti-MYC (Cell Signaling, #12189), or anti-Ki67 antibodies in phosphate-buffered saline (PBS) containing 2% FBS at 4 °C for 20 min.
For primary samples, cells were double stained with APC or PE-conjugated anti-CD138 (Beckman-Coulter, Brea, CA, USA). Flow cytometry analysis was done on a Fortessa flow cytometer (BD, Mountain View, CA, USA).

Herviou L., Kassambara A., Boireau S., Robert N., Requirand G., Müller-Tidow C., Vincent L., Seckinger A., Goldschmidt H., Cartron G., Hose D., Cavalli G, & Moreaux J. (2018). PRC2 targeting is a therapeutic strategy for EZ score defined high-risk multiple myeloma patients and overcome resistance to IMiDs. Clinical Epigenetics, 10, 121.

+ Open protocol

+ Expand

Western Blot Analysis of FOXN1 Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Western blot analysis, 4D6 were treated with lysis buffer [25 mM tris-HCL (pH7.5), 50 mM NaCl (Sigma-Aldrich), 0.1% NP-40 (Sigma-Aldrich), 0.1% SDS (Sigma-Aldrich), 0.5% sodium deoxycholate (Sigma-Aldrich), 10% glycerol (Sigma-Aldrich), and protease inhibitors (1 tablet/10 ml; Roche)] followed by SDS–polyacrylamide gel electrophoresis and immunoblotting, using mouse anti-FLAG (monoclonal M2, Merck), rabbit anti-myc (Cell Signaling Technology), and rabbit anti–glyceraldehyde phosphate dehydrogenase (GAPDH) (Cell Signaling Technology) antibodies. For the relative quantification of FOXN1 in Fig. 1C, the loading control was run through the gel from the same loading well as the experimental sample. After the protein transfer, the membrane was cut in two parts at about 50 kDa, and each part was developed separately with anti-FLAG (top part) and anti-GAPDH (bottom part). For the relative quantification of FOXN1 protein levels, the fluorescence intensity of WT or Δ550 mutant FOXN1 protein bands were calculated relative to the fluorescence intensity of the GAPDH loading control after subtracting background fluorescence.

Rota I.A., Handel A.E., Maio S., Klein F., Dhalla F., Deadman M.E., Cheuk S., Newman J.A., Michaels Y.S., Zuklys S., Prevot N., Hublitz P., Charles P.D., Gkazi A.S., Adamopoulou E., Qasim W., Davies E.G., Hanson I., Pagnamenta A.T., Camps C., Dreau H.M., White A., James K., Fischer R., Gileadi O., Taylor J.C., Fulga T., Lagerholm B.C., Anderson G., Sezgin E, & Holländer G.A. (2021). FOXN1 forms higher-order nuclear condensates displaced by mutations causing immunodeficiency. Science Advances, 7(49), eabj9247.

+ Open protocol

+ Expand

Biochemical Characterization of Protein Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sulfo-NHS-LC-biotin, streptavidin agarose resin beads, Dynabeads Protein G, Turbofect Transfection Reagent and restriction enzymes were purchased from Thermo Fisher Scientific (Carlsbad, CA, USA). Glutathione Sepharose 4B was purchased from GE Healthcare Life Sciences (Piscataway, PA, USA). The γ-secretase inhibitor Compound E was purchased from Millipore (San Diego, CA, USA). 6-carboxyfluorescein (FAM)-Aβ was purchased from AnaSpec (Fremont, CA, USA). The following antibodies were used in this study: mouse anti-Myc (for immunoblot, Life Technologies, Carlsbad, CA, USA); rabbit anti-Myc (for immunostaining) and rabbit anti-PDI (Cell Signaling Technology, Danvers, MA, USA); sheep anti-Myc (for immunostaining, Thermo Fisher, Carlsbad, CA, USA); sheep anti-TGN46 (GeneTex, Irvine, CA, USA); mouse anti-nicastrin (Abcam, Cambridge, MA, USA); rabbit anti-PS1-NTF (Ab14) antibody (developed in-house previously); mouse anti-PS1 loop (Millipore); goat anti-human TREM2 and sheep anti-mouse TREM2 (R&D Systems, Minneapolis, MN, USA); mouse anti-β-actin (Sigma, St Louis, MO, USA); rabbit anti-GST, normal mouse IgG and rabbit IgG (Santa Cruz Biotechnology, Dallas, TX, USA).

Zhao Y., Li X., Huang T., Jiang L.L., Tan Z., Zhang M., Cheng I.H., Wang X., Bu G., Zhang Y.W., Wang Q, & Xu H. (2017). Intracellular trafficking of TREM2 is regulated by presenilin 1. Experimental & Molecular Medicine, 49(12), e405-.

+ Open protocol

+ Expand

Molecular Mechanisms of Inflammatory Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blot antibodies: rabbit anti-caspase-1 from Millipore and Cell Signaling; mouse anti-GAPDH, rabbit anti-beclin1, rabbit anti-HMGB1, guinea pig anti-p62 from Abcam; rabbit anti-AIM2, rabbit anti-ASC from Santa Cruz; rabbit anti-myc from Cell Signaling; mouse anti-FLAG from Sigma; rabbit anti-LC3 from Novus; RIPA buffer (Sigma) for tissue lysis, and cell lysis buffer (Cell Signaling Technology) for whole-cell lysis plus protease inhibitors. Western images quantified by densitometry using ImageJ software (National Institutes of Health). Caspase-1 activity determined using caspase-1 activity colorimetric kit (R&D Systems). Recombinant HMGB1 generously provided by Drs. Kevin Tracey and Huan Yang(22 (link)) (The Feinstein Institute for Medical Research).

Sun Q., Loughran P., Shapiro R., Shrivastava I.H., Antoine D.J., Li T., Yan Z., Fan J., Billiar T.R, & Scott M.J. (2016). Redox-dependent regulation of hepatocyte AIM2 inflammasome activation in sterile liver injury in mice. Hepatology (Baltimore, Md.), 65(1), 253-268.

+ Open protocol

+ Expand

Immunoprecipitation and Protein Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lysates were immunoprecipitated with mouse anti-Gbb (Gbb-3D6-24, DSHB). The membrane was probed with rat anti-HA at 1:1000 (Roche) and rabbit anti-Myc at 1:300 (Cell Signaling). The experimental method is detailed in Supplemental Experimental Procedures.

James R.E., Hoover K.M., Bulgari D., McLaughlin C.N., Wilson C.G., Wharton K.A., Levitan E.S, & Broihier H.T. (2014). Crimpy enables discrimination of pre and postsynaptic pools of a BMP at the Drosophila NMJ. Developmental cell, 31(5), 586-598.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!