The largest database of trusted experimental protocols

Taqman mrna assay

Manufactured by Thermo Fisher Scientific
Sourced in United States

TaqMan mRNA assays are a set of reagents used for the detection and quantification of specific mRNA molecules in samples. They utilize TaqMan technology, which is a real-time PCR method, to measure the expression levels of target genes. The assays provide a sensitive and accurate way to analyze gene expression in various biological samples.

Automatically generated - may contain errors

14 protocols using taqman mrna assay

1

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using miRNeasy Mini Kit (Qiagen) as previously described [16] (link). Gene expression was determined by real time PCR using TaqMan mRNA assays (Applied Biosystems, Foster City, CA). Target-specific PCR primers (Pax-7, MyoD, Myostatin, Myogenin, Atrogin 1, IGF-1) were obtained from Applied Biosystems. The cycle number at which the amplification plot crosses the threshold was calculated (CT), and the ΔΔCT method was used to analyze the relative changes in gene expression and normalized by β-actin.
+ Open protocol
+ Expand
2

Quantifying miRNA Expression with RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated by miRNeasy kit (Qiagen). miScript Reverse Transcription Kit (Qiagen) was used for cDNA preparation. TaqMan mRNA assays (Applied Biosystems) or miScript primer assay (Qiagen) were used for quantitative determination of the expression of human miR-29a (MS00001701) miR-29b (MS00006566) and miR-29c (MS00009303) and mouse miR-29a (MS00003262), miR-29b (MS00005936) and miR-29c (MS00001379). Expressions of U6B small nuclear RNA or β-actin were used as endogenous controls.
+ Open protocol
+ Expand
3

Reverse Transcription and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
High Capacity cDNA Reverse Transcription Kit (Life Technologies) and TaqMan mRNA assays (Life Technologies) were used to perform reverse transcription of mRNAs coding for the following proteins: RHD (assay ID: Mm00456910_m1), ERMAP (Mm_00469273_m1), GATA1 (Mm01352636_m1), SLC4A1 (Mm00441492_m1), CLDN13 (Mm00491038_s1), ADD2 (Mm00478923_m1), ACYP1 (Mm00481325_m1), EPB4.2 (Mm00469111_m1), EPB4.9 (Mm00469121_m1), EPOR (Mm01202755_m1), and EPO (Mm00833882_m1). The TaqMan® gene expression master mix (Life Technologies) was used for PCR reactions according to the instructions given by the manufacturer on a 7900HT real-time PCR System, as previously described [35 (link)]. Raw Ct values were calculated using the SDS software v.2.4 with GAPDH (Glycerinaldehyd-3-phosphat-Dehydrogenase) for normalization, and the comparative Ct method (2−ΔΔCt) was used to calculate fold change of expression [44 (link)]. Statistical significance of corresponding data sets between vaccinated and non-vaccinated mice were analysed with the two-tailed unpaired heteroskedastic Student´s T-test (* = p-value < 0.05).
+ Open protocol
+ Expand
4

Quantitative PCR of Mouse PFC

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from mouse prefrontal cortex and quantitative PCR performed according to manufacturer's protocol using inventoried TaqMan mRNA assays (Life Technologies, Grand Island, NY, USA), as previously described (Xiao et al., 2011 (link)). Fold changes between groups were evaluated using relative quantification (delta Ct method); β-actin was the endogenous control.
+ Open protocol
+ Expand
5

Quantification of Immune Cell Markers by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
High-Capacity cDNA Reverse Transcription Kit (Life Technologies) and TaqMan mRNA assays (Life Technologies) were used to perform reverse transcription of mRNAs coding for the following proteins: ITGA1 (assay ID: Mm01306375_m1), ITGA2 (assay ID: Mm00434371_m1), KLRG1 (assay ID: Mm00516879_m1), GZMC (assay ID: Mm01313651_m1), GZMN (assay ID: Mm00461851_m1), KLRD1 (assay ID: Mm00495182_m1), KLRB1F (assay ID: Mm04211785_m1), and CLEC2I (assay ID: Mm00777071_g1). PCR reactions were carried out with the TaqMan® gene expression master mix (Life Technologies) according to the instructions given by the manufacturer on a 7900HT real-time PCR System, as previously described [44 (link)]. Raw Ct values were calculated using the SDS software v.2.4 with GAPDH (assay ID: Mm99999915_g1) for normalization. Fold change of expression was calculated with the comparative Ct method (2-ΔΔCt) [53 (link)]. Data sets were analyzed for statistical significance using two-tailed unpaired heteroskedastic Student’s t-test (* = p<0.05).
+ Open protocol
+ Expand
6

Quantifying CFTR mRNA in Human and Mouse Islets

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from human and mouse islets were prepared as described [20 (link)]. CFTR mRNA expression was measured by RT-qPCR using primers and probes from Taqman mRNA assays (Life Technologies, California, USA). Human CFTR: Hs00357011_m1 expression was normalized against human HPRT1: 4333768 F, while mouse CFTR: Mm00445197_m1 expression was normalized against mouse HPRT1: Mm00446968. RT-qPCR runs were performed for individual batches of human (N = 5) and mouse (N = 5) islets in triplicate wells of 384-well plate on a 7900 HT RT-PCR system (Applied Biosystems, California, USA).
+ Open protocol
+ Expand
7

Quantitative RT-PCR Analysis of Erythroid Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Using High Capacity cDNA Reverse Transcription Kit (Life Technologies) and TaqMan mRNA assays (Life Technologies) we performed reverse transcription of mRNAs coding for the following proteins: RHD (assay ID: Mm00456910_m1), ERMAP (Mm_00469273_m1), ADD2 (Mm00478923_m1), ANK1 (Mm00482889_m1), PLK1 (Mm00440924_g1), CCNA2 (Mm00438063_m1), LIFR (Mm00442942_m1), and CD163 (Mm_00474091_m1). PCR reactions were performed with the TaqMan® gene expression master mix (Life Technologies) according manufacturer's protocol on a 7900HT real-time PCR System, as described previously (Al-Quraishy et al., 2014 (link)). All samples were run in duplicates and raw ct values were calculated using the SDS software v.2.4 and GAPDH was used for normalization. Fold change of expression was calculated with the comparative Ct method (2−ΔΔct) (Livak and Schmittgen, 2002 (link)). Data sets were analyzed for statistical significance using two-tailed unpaired heteroskedastic Student's t-test (*p < 0.01).
+ Open protocol
+ Expand
8

Quantitative Expression Analysis of Immune Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative real-time PCR was performed under experimental conditions identical to those described recently [28 (link)], using High Capacity cDNA Reverse Transcription Kit (Life Technologies) and TaqMan mRNA assays (Life Technologies) for reverse transcription of mRNAs encoding the following proteins: ERMAP (assay ID: Mm00469273_m1), CLDN13 (Mm00491038_s1), CD163 (Mm00474091_m1), GZMB (Mm00442837_m1), KLRB1A (Mm00726548_s1), KLRC3 (Mm00650941_m1), KLRD1 (Mm00495182_m1), NCR1 (Mm01337324_g1), KLRG1 (Mm00516879_m1), and GAPDH (Mm99999915_g1). Fold change of expression was calculated using the comparative Ct method (2−ΔΔct) [29 (link)] and data sets were analysed for statistical significance using a two-tailed unpaired heteroscedastic Student’s t test (*p < 0.01).
+ Open protocol
+ Expand
9

Quantifying Cytokine and Antioxidant mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
For real-time qPCR, the Applied Biosystems TaqMan® Fast Advanced Master Mix was used (Cat. No. 444557, Thermo Fisher Scientific, Waltham, MA, USA), alongside specific TaqMan® mRNA Assays (Cat. No. 4331182, Thermo Fisher Scientific, Waltham, MA, USA) for each gene: IL-1A (Hs00174092_m1), IL-1RN (Hs00893626_m1), IL-6 (Hs00174131_m1), IL-10 (Hs00961622_m1), TNF-A (Hs00174128_m1), IFN-G (Hs00989291_m1), SIRT1 (Hs01009006_m1), SIRT3 (Hs00953477_m1), GSS (Hs00609286_m1), SOD2 (Hs00167309_m1), ICAM1 (Hs00164932_m1), and B2M (Hs00187842_m1). Each sample was assayed in duplicate. The PCR protocol began with a cycle at 95 °C for ten minutes, followed by 40 cycles of 95 °C for 15 s and 60 °C for one minute. Fluorescence signals were collected at the end of each cycle to determine cycle threshold (Ct) values. The fold changes in mRNA expression were calculated using the relative quantification (RQ) method, where ΔCt sample = Ct_target − Ct_HK, ΔΔCt = ΔCt sample − average ΔCt control group, and RQ = 2−ΔΔCt [23 (link)]. Fold-change values above one suggest up-regulated gene expression, while values below one indicate down-regulation.
+ Open protocol
+ Expand
10

Gene Expression Analysis of Placental and Blood Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from placental tissue samples using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) or from whole blood using NucleoSpin RNA Blood Kit (Macherey-Nagel, Düren, Germany). Complementary (c) DNA synthesis in a 40-μL reaction was performed using Bio-Rad iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). TaqMan mRNA assays (Thermo Fisher Scientific, Waltham, MA) were run for analysis. The primers used were IL-1β (Integrated DNA Technologies, Coralville, IA) and IL-6 (Integrated DNA Technologies, Coralville, IA) (Table 1). mRNA expression was calculated relative to housekeeping genes: 18S (Hs99999901_s1; Applied Biosystems, Foster City, CA) and Actin (Integrated DNA Technologies, Coralville, IA) (Table 1).

Primer/Probe sequences

IL-1β
Forward5'-GAACAAGTCATCCTCATTGCC-3'
Reverse5'-CAGCCAATCTTCATTGCTCAAG-3'
Probe5'-/ /56-FAM/AGAAGTACC/ZEN/TGAGCTCGCCAGTGA/3IABkFQ//-3'
IL-6
Forward5'-GCAGATGAGTACAAAAGTCCTGA-3'
Reverse5'-TTCTGTGCCTGCAGCTTC-3'
Probe5'-/5Cy5/CAACCACAAATGCCAGCCTGCT/3IAbRQSp/-3'
Actin
Forward5'-CCTTGCACATGCCGGAG-3'
Reverse5'-ACAGAGCCTCGCCTTTG-3'
Probe5'-/5Cy5/TCATCCATGGTGAGCTGGCGG/3IAbRQSp/-3'

IL-1β, interleukin-1 beta; IL-6, interleukin 6.

Sherer et al. Coronavirus disease 2019 and pregnancy. Am J Obstet Gynecol 2021.

+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!