Truseq chemistry

Manufactured by Illumina

Sourced in United States

TruSeq chemistry is a next-generation sequencing library preparation solution developed by Illumina. It provides a standardized, efficient, and scalable method for constructing DNA libraries from a variety of sample types prior to sequencing on Illumina platforms.

Automatically generated - may contain errors

Lab products found in correlation

Novaseq 6000, by Illumina (7 mentions) Hiseq 2000, by Illumina (3 mentions) Rneasy mini kit, by Qiagen (2 mentions) Bcl2fastq2, by Illumina (2 mentions) Mirneasy micro kit, by Qiagen (2 mentions) Real time analysis, by Illumina (2 mentions) Picogreen dsdna assay, by Thermo Fisher Scientific (2 mentions) Hiseq x ten sequencer, by Illumina (2 mentions) Miseq sequencer, by Illumina (2 mentions) Iscript cdna synthesis kit, by Bio-Rad (1 mentions) Lightcycler 480, by Roche (1 mentions) Lightcycler 480 sybr green 1 master, by Roche (1 mentions) Nanodrop 2000, by Thermo Fisher Scientific (1 mentions) Qiazol lysis reagent, by Qiagen (1 mentions) Isopropanol, by Merck Group (1 mentions) Chloroform, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit 50, by Qiagen (1 mentions) 2100 bioanalyzer, by Agilent Technologies (1 mentions) Bcl2fastq2 version 2.19, by Illumina (1 mentions) Qpcr ngs library quantification kit, by Agilent Technologies (1 mentions)

Spelling variants of this product

TruSeq v3 chemistry (11 citations) TruSeq SBS v3 chemistry (11 citations) TruSeq SBS Kit v3 chemistry (3 citations) TruSeq SBS chemistry (3 citations) TruSeq SBS version 3 chemistry (3 citations) TruSeq SBS v4 chemistry (3 citations) TruSeq Rapid SBS chemistry (2 citations) Truseq v3 sequencing chemistry (2 citations) TruSeq SBS Kit v3-HS chemistry (2 citations) TruSeq version 3 chemistry (2 citations)

18 protocols using truseq chemistry

RNA Extraction, cDNA Synthesis, and RNA-seq

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed with RNeasy Mini Kit (QIAGEN) and reverse transcription was carried out with iScript cDNA Synthesis Kit (BIO-RAD, #1708891). qPCR was performed with Lightcycler 480 SYBR green I master (Roche, #4887352001) and the primers listed in Table S6 and plates were run on a Lightcycler 480 (Roche) qPCR instrument.
For RNA-seq, we used ribosomal depletion to remove rRNAs from total RNA samples, then proceed with library construction using Illumina TruSeq chemistry. Libraries are then sequenced using Illumina NovaSeq 6000 at Columbia Genome Center. We multiplexed samples in each lane, which yields targeted number of paired-end 100bp reads for each sample. We used RTA (Illumina) for base calling and bcl2fastq2 (ver. 2.20) for converting BCL to fastq format, coupled with adaptor trimming. Reads were pseudoaligned to a Kallisto index created from GRCh38 Ensembl v92 transcriptome using Kallisto (ver. 0.44.0) (Bray et al., 2016 (link)).

Neguembor M.V., Martin L., Castells-García Á., Gómez-García P.A., Vicario C., Carnevali D., Abed J.A., Granados A., Sebastian-Perez R., Sottile F., Solon J., Wu C.T., Lakadamyali M, & Cosma M.P. (2021). Transcription-mediated supercoiling regulates genome folding and loop formation. Molecular cell, 81(15), 3065-3081.e12.

+ Open protocol

+ Expand

RNA Extraction and mRNA Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

MoNNet and spheroid preparations were first washed with 3x RNase-free phosphate-buffer saline. 800 μl QIAzol lysis reagent (Qiagen, Cat#79306) was added for 5 min at room temperature, followed by the addition of 200 μl Chloroform (Fisher Chemical, Cat#C298–500), vigorous shaking for 15–30 s, incubation for 3 min at RT, and centrifugation (12,000g) at 4 °C. The aqueous upper phase was collected to a new tube, 500ul Isopropanol (Sigma, Cat#I9516–500ml) was added, vortexing was used for mixing. After 10 min incubation at RT, the solution was centrifuged (12,000g) for 10 min at 4 °C. The supernatant was removed to collect the pellet, which was briefly air-dried. 100ul RNase-free water was used to dissolve the pellet. RNeasy Mini kit50 (Qiagen, cat#74104) was used to clean the RNA - all steps performed at 4 °C. RNA concentrations were measured by Nanodrop 2000 spectrophotometer (Thermo Scientific) and bioanalyzer was used for RNA quality assessment. Poly-A pull-down was used to enrich mRNAs from total RNA samples, followed by library construction using Illumina TruSeq chemistry. Libraries were sequenced on the Illumina NovaSeq 6000 at the Columbia Genome Center, yielding ~20 million paired-end 100 bp reads for each sample. RTA (Illumina) for base calling and bcl2fastq2 (version 2.19) for converting BCL to fastq format, coupled with adaptor trimming.

Rabadan M.A., De La Cruz E.D., Rao S.B., Chen Y., Gong C., Crabtree G., Xu B., Markx S., Gogos J.A., Yuste R, & Tomer R. (2022). An in vitro model of neuronal ensembles. Nature Communications, 13, 3340.

+ Open protocol

+ Expand

RNA-seq Analysis of Mouse Ventricular Transcriptome

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse hearts were removed, the atria removed and the ventricles snap-frozen in liquid nitrogen before storing at −80 °C. RNA-seq was performed at the Genomics and High Throughput Screening Shared Resource at Columbia University. RNA was extracted from the samples with QIAGEN miRNeasy micro kit (catalog no. 217084) following the kit protocol, except 0.7 volume of 100% ethanol was used instead of 1.5 volume of 100% ethanol for binding of total RNA on to the column. We used poly(A) pull-down to enrich mRNAs from total RNA samples and then proceeded with library construction using Illumina TruSeq chemistry. Libraries were then sequenced using Illumina NovaSeq 6000. We multiplexed samples in each lane, which yielded targeted number of paired-end 100-bp reads for each sample. Real-time analysis (Illumina) was used for base calling and bcl2fastq2 (v.2.19) was used for converting BCL to fastq format, coupled with adapter trimming. We performed a pseudoalignment to a kallisto index created from transcriptomes (GRCm38) using kallisto (0.44.0). Differential gene expression analysis in the 4SA-RAD knock-in versus littermate control mice was performed using the R package DESeq2 (v.1.13.0) from unnormalized count matrix with a false discovery rate (FDR) cut-off of 0.05.

Papa A., Zakharov S.I., Katchman A.N., Kushner J.S., Chen B.X., Yang L., Liu G., Jimenez A.S., Eisert R.J., Bradshaw G.A., Dun W., Ali S.R., Rodriques A., Zhou K., Topkara V., Yang M., Morrow J.P., Tsai E.J., Karlin A., Wan E., Kalocsay M., Pitt G.S., Colecraft H.M., Ben-Johny M, & Marx S.O. (2022). Rad regulation of CaV1.2 channels controls cardiac fight-or-flight response. Nature cardiovascular research, 1(11), 1022-1038.

+ Open protocol

+ Expand

Transcriptome Profiling of HDLECs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolated total RNA from HDLECs was measured for purity and integrity (RNA integrity number [RIN], ≥8) on a 2100 Bioanalyzer (Agilent) and then sent to the JP Sulzberger Columbia Genome Center for sequencing. Poly-A pulldown was used to enrich messenger RNAs from samples, and then libraries were constructed using Illumina TruSeq chemistry. RNA sequencing experiments were run on an Illumina NovaSeq 6000 with a sequencing depth of 20 million reads per sample and a targeted number of paired-end 100–base pair reads for each sample. RTA (Illumina) was used for base calling and bcl2fastq2 version 2.19 (Illumina) was used to create FASTQ files and trim adaptors. Pseudoalignment was performed to a kallisto index created from transcriptomes (Ensembl v96, GRGm38.p6) using kallisto version 0.44.0.⁷² (link) Differentially expressed genes were determined using DESeq2 version 1.24.0.⁷³ (link) Gene set enrichment analysis was performed using clusterProfiler version 4.0.⁷⁰

Jiang Z., Waterbury Q.T., Malagola E., Fu N., Kim W., Ochiai Y., Wu F., Guha C., Shawber C.J., Yan K.S, & Wang T.C. (2023). Microbial-Dependent Recruitment of Immature Myeloid Cells Promotes Intestinal Regeneration. Cellular and Molecular Gastroenterology and Hepatology, 17(3), 321-346.

+ Open protocol

+ Expand

Quantitative DNA Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fluorometric quantitation of the genomic DNA samples was performed using the PicoGreen dsDNA assay (Thermo Fisher). PCR-free, paired-end libraries were constructed by automated liquid handlers using the Illumina TruSeq chemistry according to the manufacturer’s protocol. DNA samples underwent sequencing on an Illumina HiSeq X Ten sequencer (v.2.5 chemistry, Illumina) using 150 bp, paired-end cycles.

Chia R., Sabir M.S., Bandres-Ciga S., Saez-Atienzar S., Reynolds R.H., Gustavsson E., Walton R.L., Ahmed S., Viollet C., Ding J., Makarious M.B., Diez-Fairen M., Portley M.K., Shah Z., Abramzon Y., Hernandez D.G., Blauwendraat C., Stone D.J., Eicher J., Parkkinen L., Ansorge O., Clark L., Honig L.S., Marder K., Lemstra A., St George-Hyslop P., Londos E., Morgan K., Lashley T., Warner T.T., Jaunmuktane Z., Galasko D., Santana I., Tienari P.J., Myllykangas L., Oinas M., Cairns N.J., Morris J.C., Halliday G.M., Van Deerlin V.M., Trojanowski J.Q., Grassano M., Calvo A., Mora G., Canosa A., Floris G., Bohannan R.C., Brett F., Gan-Or Z., Geiger J.T., Moore A., May P., Krüger R., Goldstein D.S., Lopez G., Tayebi N., Sidransky E., Norcliffe-Kaufmann L., Palma J.A., Kaufmann H., Shakkottai V.G., Perkins M., Newell K.L., Gasser T., Schulte C., Landi F., Salvi E., Cusi D., Masliah E., Kim R.C., Caraway C.A., Monuki E.S., Brunetti M., Dawson T.M., Rosenthal L.S., Albert M.S., Pletnikova O., Troncoso J.C., Flanagan M.E., Mao Q., Bigio E.H., Rodríguez-Rodríguez E., Infante J., Lage C., González-Aramburu I., Sanchez-Juan P., Ghetti B., Keith J., Black S.E., Masellis M., Rogaeva E., Duyckaerts C., Brice A., Lesage S., Xiromerisiou G., Barrett M.J., Tilley B.S., Gentleman S., Logroscino G., Serrano G.E., Beach T.G., McKeith I.G., Thomas A.J., Attems J., Morris C.M., Palmer L., Love S., Troakes C., Al-Sarraj S., Hodges A.K., Aarsland D., Klein G., Kaiser S.M., Woltjer R., Pastor P., Bekris L.M., Leverenz J.B., Besser L.M., Kuzma A., Renton A.E., Goate A., Bennett D.A., Scherzer C.R., Morris H.R., Ferrari R., Albani D., Pickering-Brown S., Faber K., Kukull W.A., Morenas-Rodriguez E., Lleó A., Fortea J., Alcolea D., Clarimon J., Nalls M.A., Ferrucci L., Resnick S.M., Tanaka T., Foroud T.M., Graff-Radford N.R., Wszolek Z.K., Ferman T., Boeve B.F., Hardy J.A., Topol E.J., Torkamani A., Singleton A.B., Ryten M., Dickson D.W., Chiò A., Ross O.A., Gibbs J.R., Dalgard C.L., Traynor B.J, & Scholz S.W. (2021). Genome sequencing analysis identifies new loci associated with Lewy body dementia and provides insights into its genetic architecture. Nature genetics, 53(3), 294-303.

+ Open protocol

+ Expand

Targeted NGS for Cleft Lip/Palate

Check if the same lab product or an alternative is used in the 5 most similar protocols

Targeted, next-generation sequencing (NGS), including library construction, capture, and sequencing, was carried out at Oxford Gene Technologies (Oxford, UK). Enrichment of target regions and library preparation were performed by the use of a SureSelectXT2 Custom kit (1–499 kb, 16) in accordance with SureSelect protocol (version 1.2; Agilent Technologies, Changsha, China). Library concentrations were determined using Agilent's QPCR NGS Library Quantification Kit (G4880A), with each sample at a final concentration of 10 nmol/L. A HiSeq2000 sequencer ordered the samples using TruSeq chemistry and protocols (version 3, Illumina Inc, San Diego, CA). The TOF with CLP patient was analyzed separately using all CHD or CLP patients grouped into 1 enrichment kit and sequencing run.^{3 (link)}

Liu L., Bu H., Yang Y., Tan Z., Zhang F., Hu S, & Zhao T. (2017). A Targeted, Next-Generation Genetic Sequencing Study on Tetralogy of Fallot, Combined With Cleft Lip and Palate. The Journal of Craniofacial Surgery, 28(4), e351-e355.

+ Open protocol

+ Expand

qPCR and RNA-Seq Analysis of C. elegans

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qPCR and RNA-Seq experiments, total RNA from age-synchronized young adult (24 hrs post-L4) hermaphrodites (200 in total, picked manually) was prepared using TissueRuptor and the RNeasy Mini kit (Qiagen). Reverse transcription was performed by SuperScript III, and quantitative PCR was performed using Applied Biosystems Real-Time PCR Instruments. The specific intron-spanning primer sequences used were: act-3 forward – TCCATCATGAAGTGCGACAT; act-3 reverse – TAGATCCTCCGATCCAGACG; fat-7 forward – ACGAGCTTGTCTTCCATGCT; fat-7 reverse – AGCCCATTCAATGATGTCGT; acdh-11 forward – TTGATCCATTTGTTCGGAGA; acdh-11 reverse – GGTGGCTAGCTTGTGCTTTC. RNA-Seq was performed by the Illumina TruSeq chemistry, and data were analyzed using standard protocols (Trapnell et al., 2010 (link)).
Nomarski and GFP fluorescence images of anesthetized C. elegans were obtained using an Axioskop II (Zeiss) compound microscope and OpenLab software (Agilent). The fraction of FAT-7::GFP-positive animals observed was quantified by counting animals using a dissecting microscope equipped for the detection of GFP fluorescence.

Ma D.K., Li Z., Lu A.Y., Sun F., Chen S., Rothe M., Menzel R., Sun F, & Horvitz H.R. (2015). Acyl-CoA dehydrogenase drives heat adaptation by sequestering fatty acids. Cell, 161(5), 1152-1163.

+ Open protocol

+ Expand

Comprehensive Mouse Genome Sequencing Protocol

Cited 4 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Approximately 1 μg of gDNA was prepared for fragment-sequencing libraries and then processed according to standard protocols using TruSeq chemistry (Illumina, San Diego, CA, USA). Mate-pair libraries were prepared using Nextera Mate Pair Sample Prep Kit according to manufacturers instructions (Illumina, San Diego, CA, USA). Paired-end sequencing (2 × 100 bp) on HiSeq2000 (Illumina) was applied to achieve 1-30-fold mapped read coverage across the entire genome depending on required depth (Supplementary Data 7). Reads were aligned using Bowtie2 v2.1.0 (Langmead and Salzberg 2012) to mouse reference genome mm10 (Dec. 2011 GRCm38/mm10). Duplicates were identified and removed from the aligned data using Picard's Mark Duplicates v1.89 (Broad Institute, Boston, MA, USA). BreakDancer v1.3.5 (ref. 37 (link)), CREST v0.0.1 (ref. 38 (link)) and Socrates v0.9.5 (ref. 39 (link)) were employed to identify structural variants. Whole genome de novo assembly was undertaken using Gossamer40 (link) to compare resulting contigs with the genomic sequence relevant to the transgene. Control-FREEC (ref. 41 (link)) was used to call somatic copy-number alterations using tail88 as the germline control. A window size of 50,000 bp was used.

Lefebure M., Tothill R.W., Kruse E., Hawkins E.D., Shortt J., Matthews G.M., Gregory G.P., Martin B.P., Kelly M.J., Todorovski I., Doyle M.A., Lupat R., Li J., Schroeder J., Wall M., Craig S., Poortinga G., Cameron D., Bywater M., Kats L., Gearhart M.D., Bardwell V.J., Dickins R.A., Hannan R.D., Papenfuss A.T, & Johnstone R.W. (2017). Genomic characterisation of Eμ-Myc mouse lymphomas identifies Bcor as a Myc co-operative tumour-suppressor gene. Nature Communications, 8, 14581.

+ Open protocol

+ Expand

RNA-seq Analysis of Murine CD4+ T Cell Transcriptome

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

After 72 h of polarization under polarizing conditions indicated above in “CD4+ T cell isolation and culture”, 4 independent in vitro cultured murine CD4+ cells were collected. RNAs from these samples were extracted (RNeasy kit, Qiagen). RNA-seq with pair-end 100-nt read length was performed at the Turku Center for Biotechnology with HiSeq 2000 instrument using Illumina TruSeq chemistry according to the manufacture’s instruction.
The RNA-seq data were mapped using Tophat (version 2.0.14) with default parameters to the mm10 mouse reference genome. Read counts were computed with HTSeq-count [72 (link)], with options stranded false, feature type exon, and sorted by name and mode union. Negative binomial generalized log-linear model to the read counts for each gene was fitted, and gene-wise statistical tests using pair-wise experimental design were performed with Bioconductor edgeR package [73 (link)]. The data were normalized using model-based scaling [74 (link)]. The tag-wise dispersions for the generalized linear models were empirical Bayes estimates with expression levels specified by a log-linear model [75 (link)]. Genes that did not have more than 1 count per million (cpm) at least in 4 samples were filtered out of the analysis.

Mohammad I., Nousiainen K., Bhosale S.D., Starskaia I., Moulder R., Rokka A., Cheng F., Mohanasundaram P., Eriksson J.E., Goodlett D.R., Lähdesmäki H, & Chen Z. (2018). Quantitative proteomic characterization and comparison of T helper 17 and induced regulatory T cells. PLoS Biology, 16(5), e2004194.

+ Open protocol

+ Expand

RNA-seq Analysis of Mouse Ventricular Transcriptome

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!