Vaccinia virus capping kit

A synthetic 5′-triphosphate-containing 20-nt-long RNA (ppAAUCUAUAAUAGCAUUAUCC; Chemgenes) was capped with a radiolabeled cap-1 structure by using 0.25 μM [α-³²P]GTP (3,000 Ci mmol⁻¹; Perkin-Elmer), 2.5 U/μl 2′-O-methyltransferase (NEB), and a vaccinia virus capping kit (NEB), according the manufacturers' instructions. The product was analyzed by 20% denaturing PAGE, excised from the gel, and desalted by using NAP-10 columns (GE Healthcare) that had been equilibrated with RNase-free water. To test the endonuclease activity of the IAV RdRp, we performed reactions with 3-μl mixtures that contained 1 mM DTT, 0.7 μM vRNA promoter (Sigma), 5 mM MgCl₂, 1 U μl⁻¹ RNasin (Promega), 1,500 cpm capped 20-nucleotide-long RNA primer, 5% glycerol, 0.05% NP-40, 75 mM NaCl, 10 mM HEPES (pH 7.5), and ∼2 ng RdRp μl⁻¹. The reaction mixtures were incubated for 1 h at 30°C, and the reactions were stopped with 4 μl loading buffer and analyzed by 20% denaturing PAGE. The capped RNA cleavage products were visualized by phosphorimaging.

Synthetic 5′ tri- or diphosphate-containing RNAs of 11 nt (Table 1) (Chemgenes) were capped with a radiolabeled cap-1 structure by using 0.25 μM [α-³²P]GTP (3,000 Ci mmol⁻¹; Perkin-Elmer), 2.5 U/μl 2′-O-methyltransferase (NEB), and a vaccinia virus capping kit (NEB). The products were denatured in formamide and purified as described previously (6 (link)).