Rna extraction kit

Manufactured by EZBioscience

Sourced in United States, China

The RNA extraction kit is a laboratory product designed to isolate and purify ribonucleic acid (RNA) from various biological samples. It provides a standardized and efficient method for extracting RNA, which is a crucial biomolecule required for various downstream applications in molecular biology, genomics, and biotechnology.

Automatically generated - may contain errors

Lab products found in correlation

Reverse transcription kit, by Vazyme (2 mentions) Nanodrop 2000, by Thermo Fisher Scientific (2 mentions) Lightcycler 480 2 real time pcr instrument, by Roche (1 mentions) Rna reverse transcription kit, by Vazyme (1 mentions) Lightcycler 480 2, by Roche (1 mentions) Cfx connect system, by Bio-Rad (1 mentions) Reverse transcription kit, by EZBioscience (1 mentions) Real time pcr instrument, by Thermo Fisher Scientific (1 mentions) Sybr green pcr master mix, by Vazyme (1 mentions) Gapdh, by Generay (1 mentions) Quantstudio 6 real time pcr system, by Thermo Fisher Scientific (1 mentions)

7 protocols using rna extraction kit

Real-time PCR analysis of gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

After 24 h of transfection, cells were collected via trypsinization. RNA was extracted by using RNA extraction kit (EZBioscience, USA) and reverse transcribed to cDNA via a reverse transcription kit (Vazyme, China) following the manufacturer's protocol. One microlitre of cDNA and primers (Table 2) were mixed with 2xChamQ Universal SYBR qPCR Master Mix in 10 reaction volumes. Relative mRNA expression was detected by using a LightCycler 480 II Real-time PCR instrument (Roche, Swiss).Table 2

The primer sequences.

Table 2

Gene	Forward	Reverse
ZNF268	TTGTGGATTTTACCTGGGAGGA	TGCACCATACACAGCTCTTCT
GAPDH	GAGTCAACGGATTTGGTCGT	GACAAGCTTCCCGTTCTCAG

Wu W., Yao S., Huang J., Qing J., Shi Q., Huang J., Qiu X, & Zhuang Y. (2023). The Expression of ZNF268 and Its Role in The Cisplatin-based Chemoresistance of Breast Cancer. Heliyon, 9(8), e18779.

+ Open protocol

+ Expand

Quantitative PCR analysis of Gper expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For quantitative PCR (qPCR) on a LightCycler 480 II (Roche) system, total TG RNA was extracted with an RNA Extraction Kit (EZBioscience), cDNA was synthesized with an RNA Reverse Transcription Kit (Vazyme) and further mixed with SYBR Green PCR mix (EZ Bioscience). The primer sequences (5′–3′) used for cDNA amplification were as follows: Gper, CCTGCTACTCCCTCATCG (forward) and ACTATGTGGCCTGTCAAGGG (reverse); Gapdh, AAGAAGGTGGGTGACAGGCATC (forward) and CGGCACATCGGAGGAATG (reverse). We chose Gapdh as the loading control and applied the 2−ΔΔCT method to calculate the relative expression levels of the Gper mRNA.

Li J., Gao P., Zhang S., Lin X., Chen J., Zhang S., Jiao Y., Yu W., Xia X, & Yang L. (2023). The G protein‐coupled estrogen receptor of the trigeminal ganglion regulates acute and chronic itch in mice. CNS Neuroscience & Therapeutics, 30(2), e14367.

+ Open protocol

+ Expand

RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted by using an RNA extraction kit (EZBioscience, Shanghai, China) according to the manufacturer’s manual. The cDNA was synthesized with Hifair III 1st strand cDNA (Yeasen, Shanghai, China) and mixed with PerfectStart SYBR Green SuperMix (TransGen Biotech, Beijing, China), followed by quantification of gene expression with the BioRad CFX Connect system. The primer sequences used in our study are described in Table S1.

Wang C., Liu Y., Liu X., Zhao J., Lang B., Wu F., Wen Z, & Sun C. (2023). IFN-Inducible SerpinA5 Triggers Antiviral Immunity by Regulating STAT1 Phosphorylation and Nuclear Translocation. International Journal of Molecular Sciences, 24(6), 5458.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The culture medium was discarded, and the treated cells were washed with PBS. Total cellular RNA was extracted using the RNA extraction kit (EZBioscience; USA) according to the manufacturer's instructions. The cDNA was synthesized using the reverse transcription kit (EZBioscience; USA) according to the corresponding RNA concentration determined by Nanodrop 2000 (Thermo; US). 10 ul of the reaction system was finally prepared for PCR detection using the PCR kit (EZBioscience; USA). The Ct values were read, and GAPDH was used as a reference to analyze gene expression levels. The primers for the genes used in this study are shown in Table S2 (Supporting Information).

Yang J., Zhang X., Lu B., Mei J., Xu L., Zhang X., Su Z., Xu W., Fang S., Zhu C., Xu D, & Zhu W. (2023). Inflammation‐Responsive Hydrogel Spray for Synergistic Prevention of Traumatic Heterotopic Ossification via Dual‐Homeostatic Modulation Strategy. Advanced Science, 10(30), 2302905.

+ Open protocol

+ Expand

Quantifying Gene Expression Changes in hADSCs and KFs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative real‐time polymerase chain reaction (qRT‐PCR) assessed gene expression changes in hADSCs post‐modRNA transfection and KFs upon coculture with modified hADSCs. Total RNA was extracted using an RNA extraction kit (EZBioscience, MN, USA), treated with DNase, and converted into cDNA using a reverse transcription kit (Vazyme, Nanjing, China) from 1 μg RNA. qRT‐PCR was performed using SYBR Green PCR Master Mix (Vazyme) on a Thermo Fisher Scientific real‐time PCR instrument. The cycling conditions included an initial denaturation step (95°C, 10 min), followed by 40 cycles (95°C, 15 s; 60°C, 1 min). Gene expression levels were calculated using the 2^−ΔΔCt method and normalized to GAPDH. Primer details are provided in Table S2.

Wang W., Chen L., Zhang Y., Wang H., Dong D., Zhu J., Fu W, & Liu T. (2023). Adipose‐derived stem cells enriched with therapeutic mRNA TGF‐β3 and IL‐10 synergistically promote scar‐less wound healing in preclinical models. Bioengineering & Translational Medicine, 9(2), e10620.

+ Open protocol

+ Expand

Quantifying Gene Expression in HUVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from HUVECs at a density of 5x10⁵ cells/well using an RNA extraction kit (EZBioscience). Subsequently, ~1 µg of total RNA was reverse transcribed into cDNA using the Evo M-MLV Reverse Transcription kit (cat. no. AG11705; Accurate Biology). The target genes ICAM-1, VCAM-1 and the internal reference gene GAPDH were amplified by qPCR using the 2X SYBR^® Green Pro Taq HS Premix (cat. no. AG11718; Accurate Biology) kit. The thermocycling conditions used were as follows: For gDNA removal: 2 min at 42˚C, followed by keeping at 4˚C; for reverse transcription PCR: 15 min at 37˚C and 5 sec at 85˚C, followed by keeping at 4˚C; and for qPCR: 95˚C for 30 sec, followed by 40 cycles at 95˚C for 5 sec and 60˚C for 30 sec, followed by dissociation stage. All of the above steps were performed according to the manufacturer's protocols. The primer sequences used were as follows: VCAM-1, forward, 5'-GAGATACAACCGTCTTGG-3' and reverse, 5'-CCTTCACATAAATAAACCC-3'; ICAM-1, forward, 5'-ATGGCAACGACTCCTTCTC-3' and reverse, 5'-TGTCACCTCGGTCCCTTC-3'; and GAPDH, forward, 5'-TCTGACTTCAACAGCGACACC-3' and reverse, 5'-CTGTTGCTGTAGCCAAATTCGTT-3' (Generay Biotech Co., Ltd.). The amplification data were quantified using the 2^-ΔΔCq method (16 (link)) and the relative expression levels of target genes were then calculated. These experiments were replicated in triplicate.

Zhao W., Wei H., Lu J., Sha W., Sun D., Pan T, & Lei T. (2023). Tyrosol attenuates lipopolysaccharide‑induced inflammation in HUVECs to promote vascular health against atherosclerosis challenge. Experimental and Therapeutic Medicine, 25(5), 240.

+ Open protocol

+ Expand

Placental RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to the manufacturer's instructions, the total placental RNA was extracted using the RNA extraction kit (EZBioscience, Guangzhou, China). The A260/A280 ratio of the RNA used for the experiment should be between 1.8 and 2.0. After reverse transcription using Primer Script RT reagent Kit (EZBioscience, Guangzhou, China), RT-qPCR was performed to analyze the expression levels of related genes on a Quant Studio 6 RealTime PCR System (Thermo Fisher, Waltham, USA). The relative expression was calculated using the comparative method (2^−ΔΔCt), with β-actin as the internal control. The primers used in the experiments are listed in Table S4.

Ma K., Su B., Li F., Li J., Nie J., Xiong W., Luo J., Huang S., Zhou T., Liang X., Li F., Deng J, & Tan C. (2024). Maternal or post-weaning dietary fructo-oligosaccharide supplementation reduces stillbirth rate of sows and diarrhea of weaned piglets. Animal Nutrition, 17, 155-164.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!