Oligonucleotide

Manufactured by Gene Tools

Sourced in Macao

Oligonucleotides are short sequences of synthetic DNA or RNA molecules, typically ranging from 10 to 25 nucleotides in length. They are used as essential laboratory tools in various molecular biology and genetic research applications.

Automatically generated - may contain errors

Lab products found in correlation

Mmessage mmachine system, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Morpholino antisense oligonucleotides (102 citations) Morpholino oligonucleotides (77 citations) Morpholino oligonucleotides (MOs) (23 citations) Antisense morpholino oligonucleotides (MOs) (19 citations) Morpholino antisense oligonucleotides (MOs) (12 citations) Standard control oligonucleotide (7 citations) MO oligonucleotides (6 citations) Morpholino-modified antisense oligonucleotides (MOs) (6 citations) MO antisense oligonucleotides (4 citations) Morpholino-modified antisense oligonucleotides (4 citations)

4 protocols using oligonucleotide

CD47 Knockdown and Fracture Healing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression of CD47 was disrupted using a translation-blocking antisense morpholino oligonucleotide. On days 2 and 5 post-fracture, mice were injected intraperitoneally using a 23-gauge needle with 1.0 nmol/g of morpholino in 750 μl of saline. Mice were injected with either a CD47 antisense vivo-morpholino (CGTCACAGGCAGGACCCACTGCCCA) or a vivo-morpholino standard control (CCTCTTACCTCAGTTACAATTTATA) oligonucleotide (Gene Tools, Philomath, OR).

Hankenson K., Zondervan R., Capobianco C., Jenkins D., Reicha J., Frederick L., Lam C., Isenberg J., Ahn J, & Marcucio R.S. (2024). CD47 is Required for Mesenchymal Progenitor Proliferation and Fracture Repair. Research Square.

+ Open protocol

+ Expand

CD47 Knockdown and Fracture Healing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Zondervan R.L., Capobianco C.A., Jenkins D.C., Reicha J.D., Fredrick L.M., Lam C., Isenberg J.S., Ahn J., Marcucio R.S, & Hankenson K.D. (2024). CD47 is Required for Mesenchymal Progenitor Proliferation and Fracture Repair. bioRxiv.

+ Open protocol

+ Expand

Cdx4 Knockdown in Cell Transplantation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell transplantation experiments were performed as previously described
(Ho and Kane, 1990 (link)). To knockdown
Cdx4 function, antisense cdx4 morpholino (1 nl at 20
ng/μl, as described by Davidson et al.,
2003 and Skromne et al., 2007 (link))
oligonucleotides (Gene Tools LLC) were injected into one-cell stage donor or
host embryos, as described (Skromne et al.,
2007). In addition, donor embryos were injected with 10 kDa lysinated
Alexa Fluor 647 (Life Technologies D-22914; 0.5% in 0.2M KCl, as described by
Love & Prince, 2015 (link)). ~ 30
cells from blastula-stage (4 hpf) donor embryos were transplanted into the
margins of blastula-stage hosts. Chimeric embryos were allowed to develop to 25
hpf and fixed in 4% PFA at 4°C overnight. To avoid cardiac and vagal NC
cells, only NC cells adjacent to somite four and posterior were included in this
analysis. Moreover, only those specimens in which >20% of the
dorsoventral extent of one of more somites was populated by transplanted
donor-derived cells were selected for further analysis.

Rocha M., Kushkowski E., Schnirman R., Booth C., Singh N., Beadell A, & Prince V.E. (2021). Zebrafish Cdx4 regulates neural crest cell specification and migratory behaviors in the posterior body. Developmental biology, 480, 25-38.

+ Open protocol

+ Expand

Zebrafish Thsd7a Gene Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Morpholino phosphorodiamidate oligonucleotides (morpholino, MO) were synthesized by Gene Tools (Philomath, OR) to target splice junctions of the zebrafish thsd7a gene. The MO sequences were as follows: MO1, 5′-TGTATGTTTTTACCCACCATGACTG-3′; 5-base mismatch control for MO1 (msMO1), 5′-TCTATCTTTTTAGCCACGATGAGTG-3′; MO2, 5′-GTGCCA GTTTTGTTACCGTCTTTGC-3′; 5-base mismatch control for MO2 (msMO2), 5′-GTCCCACTTTTCTTACGGTCTTTCC-3′. The injection dosage used is 2 ng of MO1 and 9 ng of MO2 to each embryo. Thsd7a mRNA was synthesized using the mMESSAGE mMACHINE system (Ambion, Autstin, TX) with SP6 RNA polymerase. Murine Notch gene homolog 1 (Notch1) was cloned downstream of the CMV promoter in the pTCN vector (BC138442; constructed by transOMIC. Huntsville, AL). Co-injection of MO1 with 0.4 ng of thsd7a mRNA or 12.5 pg of notch1 construct into zebrafish embryos were performed at one-cell stage of development.

Liu L.Y., Lin M.H., Lai Z.Y., Jiang J.P., Huang Y.C., Jao L.E, & Chuang Y.J. (2016). Motor neuron-derived Thsd7a is essential for zebrafish vascular development via the Notch-dll4 signaling pathway. Journal of Biomedical Science, 23, 59.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!