Chromo4 real time pcr detector system

Total RNAs isolated using the RNeasy Mini kit (Qiagen, Courtaboeuf, France) were reverse transcribed to cDNA with the ABsolute Blue verso 2-step kit and subjected to quantitative real-time PCR by using the Absolute SYBR Green mix (Thermo Fisher Scientific, Epsom, Surrey, UK) and a Chromo4 Real-Time PCR Detector system from Bio-Rad. Primers for LRP-1 were previously described (9 (link)). Primers for calpain 1, calpain 2 and β-actin were designed by Eurogentec (Seraing, Belgium) as follows: calpain 1: forward, CCTTGAGGATGATCTGGTAGA; reverse, AGCTAGTGTTCGTGCACTCTG; calpain 2: forward: CTGGAGATCTGTAACCTGACC; reverse: GGTACTGAGGGTTCATCCAGA; β-actin: forward: GTGTGACGTGGACATCCGC; reverse: CTGCATCCTGTCGGCAATG. The relative levels of expression were quantified by using Opticon Monitor software (Bio-Rad). For each specific gene, the amount of target RNA (2^-ΔΔCt) was normalized to the internal actin reference (ΔCt) and related to the amount of target RNA in control sample, set to 1. All experiments were performed at least in triplicate with internal duplicate for each sample.

To validate the results of RNA-Seq, 12 genes were selected as targets for quantitative real-time PCR analysis. The first-strand cDNA was synthesized using 5 μg RNA samples and M-MLV reverse transcriptase (TaKaRa). The cDNA product was diluted ten times, and 1 μL was used in a 20-μL PCR reaction.
The PCR amplification consisted of a preincubation at 95 °C for 5 min and 40 cycles each 15 s at 95 °C, 15 s at 60 °C, and 15 s at72°C. These reactions used the Chromo4 real-time PCR detector system (Bio-Rad, USA) and iQ SYBR green supermix (Bio-Rad). To normalize the cDNA templates, the housekeeping gene EF1α was co-amplified. All primers (Additional file 1) were synthesized by Invitrogen.