DNA templates for reference and clinical isolates were prepared using the boiled lysates method. A single colony was suspended in 50 μl of distilled water, then boiled at 100°C for 8 min and centrifuged at 12,000×g for 10 min, with supernatant used as DNA template. Plasmid DNA templates were extracted from two E. coli TOP10 strains using the SanPrep Plasmid MiniPrep Kit (Sangon Biotech Co. Ltd., Shanghai, China). The concentration of all DNA templates was measured spectrophotometrically (Nanodrop ND-1000, Wilmington, Delaware, USA).
Sanprep plasmid miniprep kit
Manufactured by Sangon
Sourced in China
The SanPrep Plasmid MiniPrep Kit is a laboratory product designed for the rapid and efficient extraction of plasmid DNA from bacterial cultures. It provides a simple and reliable method for purifying high-quality plasmid DNA suitable for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
7 protocols using sanprep plasmid miniprep kit
1
Rapid DNA Extraction for Genomic Analysis
2
Generating M. pneumoniae DNA Standard for CPA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aimed at generating a M. pneumoniae standard DNA for the CPA technique, a 192 bp PCR product from the p1 gene was amplified from the M. pneumoniae DNA using 5´-GGATCC (BamHI) GTGAACGTATCGTAACACGAGCTT-3´ and 5´-GTCGAC (SalI) TCATACCGGCGTAACGCAAAG-3´ as primers, and then cloned into the plasmid PUC57(1) (Takara, Dalian, China) to produce standard templates. The generated plasmid, PUC57(1)p1, was transformed into Escherichia coli DH5α (Takara, Dalian, China) cells and the positive clones were identified by sequencing (Sangon Biotech, Shanghai, China) with the primers listed above. PUC57(1)p1 was purified with the SanPrep Plasmid MiniPrep Kit (Sangon Biotech, Shanghai, China) and quantified with a NanoDrop 2000 spectrophotometer (Thermo Scientific, Shanghai, China). The copy number of DNA molecules was calculated according to the following formula: amount (copies/μl) = [DNA concentration (g/μl)/(plasmid length in base pairs × 660)] × 6.02 × 1023. Aliquots of the standard DNA were prepared in tenfold serial dilutions from 5.0 × 103 to 5.0 × 102 copies / mL in nuclease-free water and stored at − 80 °C until used.
3
V. parahaemolyticus Strain Isolation and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All V. parahaemolyticus strains were revived and cultured in Vibrio chromogenic agar (Guangdong Huankai Microbial Science and Technology, Guangzhou, China) at 37°C for 12 h to isolate single colonies. Individual colonies were then selected and cultured in 3 ml of alkaline peptone water (Guangdong Huankai Microbial Science and Technology), after which they were incubated at 37°C for 16 h while shaking at 200 rpm. Escherichia coli TOP10 strains were cultured in normal LB medium under the same conditions. Genomic DNA templates were extracted using the boiled lysates method, in which 1 ml of each culture was boiled at 100°C for 8 min. After boiling, the suspension was centrifuged for 10 min at 12,000 rpm. The supernatant was then used as the DNA template. Plasmid DNA templates were extracted using a SanPrep Plasmid MiniPrep Kit (Sangon Biotech Co. Ltd.). K-serogroups of all V. parahaemolyticus strains were identified using commercial antisera based on agglutination tests (Denka Seiken, Tokyo, Japan) according to the manufacturer’s protocol and the Chinese National Food Safety Standards: Food Microbiological Examination Vibrio parahaemolyticus Testing, GB 4789.7-2013.
4
Rapid Detection of Canine Parvovirus using RT-RPA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate a CPV-2 standard DNA for the real-time RPA, a PCR product containing 1755 bp covering the region of interest of VP2 was amplified from the CPV-2a DNA using VP2-Forward and VP2-Reverse as primers (Table 2 ) and cloned into the pMD19-T vector using the pMD19-T Vector Cloning Kit (Takara) according to manufacturer’s instructions. The resulting plasmid, pCPV-VP2, was transformed into Escherichia coli DH5α cells, and the positive clones were confirmed by sequencing using M13 primers (Invitrogen®, Carlsbad, CA, USA). pCPV-VP2 was purified with the SanPrep Plasmid MiniPrep Kit (Sangon Biotech Co., Ltd., Shanghai, China) and quantified using a ND-2000c spectrophotometer. The copy number of DNA molecules was calculated by the following formula: amount (copies/μL) = [DNA concentration (g/μL) / (plasmid length in base pairs × 660)] × 6.02 × 1023.
Sequences of primers and probes for CPV-2 PCR, real-time PCR and real-time RPA assay
| Name | Sequence 5′-3’Amplication size (bp) | |
|---|---|---|
| VP2-FP | ATGAGTGATGGAGCAGTTCAACCAGAC | 1775 |
| VP2-RP | TTAATATAATTTTCTAGGTGCTAGTTGA | |
| CPV-FP | AAACAGGAATTAACTATACTAATATATTTA | 93 |
| CPV-RP | AAATTTGACCATTTGGATAAACT | |
| CPV-P | FAM-TGGTCCTTTAACTGCATTAAATAATG TACC-BHQ1 | |
| CPV-RPA-FP | CACTTACTAAGAACAGGTGATGAATTTGCT ACAG | 214 |
| CPV-RPA-RP | AGTTTGTATTTCCCATTTGAGTTACACCACGTCT | |
| CPV-RPA-P | CCTCAAGCTGAAGGAGGTACTAACTTTGGT/ |
5
Cloning FHV-1 Thymidine Kinase Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FHV-1 TK gene was amplified by PCR using following primers: forward primer, 5’- GGACAGCATAAAAGCGATTG-3’; and reverse primer, 5’-CAACTAGATTTCCACCAGGA-3’. The template was FHV-1 nucleic acid. The TK gene was cloned into plasmid pMD19-T using the pMD19-T Vector Cloning Kit (Takara Bio Inc.) following the manufacturer’s instructions. Subsequently, recombinant clones were screened by PCR and validated by DNA sequencing. The resultant recombinant plasmid, termed pMD19-T-TK, was replicated in E.coli DH5α cells, extracted and purified using the SanPrep Plasmid MiniPrep Kit (Sangon Biotech Co. Ltd, Shanghai, China). Plasmid DNA was quantified using a ND-1000 spectrophotometer.
6
Generation of M. bovis uvrC Standard
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aimed to generate a M. bovis-standard DNA for the RPA assays, a PCR product with 1,908 bp covering the region of interest of uvrC gene, was amplified from the M. bovis DNA using uvrC-F and uvrC-R as primers (Table 1
7
Generating M. Ovipneumoniae DNA Standards for RPA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate a M. Ovipneumoniae standard DNA for the RPA assays, a PCR product containing 361 bp covering the region of interest of 16SrRNA gene was ampli ed from the M. Ovipneumoniae DNA using LMF1 and LMR1 as primers (Table 1) and cloned into the pMD19-T (Takara, Dalian, China) for standards. The resulting plasmid, pMO-16SrRNA, was transformed into Escherichia coli DH5α cells, puri ed with the SanPrep Plasmid MiniPrep Kit (Sangon Biotech, Shanghai, China) and quanti ed using a ND-2000c spectrophotometer. The copy number of DNA molecules was calculated by the following formula: amount (copies/μL) = [DNA concentration (g/μL)/ (plasmid length in base pairs×660)] ×6.02×10 23 . Tenfold dilutions of the pMO-16SrRNA, ranging from 1.0×10 7 to 1.0×10 0 copies/μL, were prepared in nuclease-free water and aliquots of each dilution were stored at -80 •C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!