Paired end adapter sequences

Manufactured by Illumina

Paired-end adapter sequences are oligonucleotide sequences designed to be ligated to DNA fragments during sample preparation for next-generation sequencing. These adapter sequences enable the generation of paired-end reads, where both ends of a DNA fragment are sequenced, providing additional information about the original DNA fragment.

Automatically generated - may contain errors

Lab products found in correlation

Powerlyzer powersoil dna isolation kit, by Qiagen (1 mentions) Kapa library quantification kit, by Roche (1 mentions) Dneasy blood tissue kit, by Qiagen (1 mentions) Agencourt ampure xp kit, by Beckman Coulter (1 mentions)

Spelling variants of this product

Paired-end adapters (57 citations) Illumina adapters (41 citations) Illumina adapter sequences (6 citations)

2 protocols using paired end adapter sequences

16S rRNA Profiling of Infant Gut Microbiome

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from neonate stool samples (term: n = 7, pre-term: n = 10) using the Powerlyzer Powersoil DNA isolation kit (Qiagen 12855) according to manufacturer’s specifications with slight modifications. The V1-V3 hypervariable region of the 16S rRNA gene was amplified using primer pair 8F (5′- AGAGTTTGATCCTGGCTCAG − 3′) and 534R (5′-ATTACCGCGGCTGCTGG-3′) as previously described [51 (link)]. Briefly, forward and reverse primers contained universal Illumina paired-end adapter sequences with unique barcodes between the PCR primer sequence and the Illumina adapter sequence to allow multiplex sequencing. Equimolar amounts of samples were then pooled and sequenced with an Illumina MiSeq.

Dougherty M.W., Kudin O., Mühlbauer M., Neu J., Gharaibeh R.Z, & Jobin C. (2020). Gut microbiota maturation during early human life induces enterocyte proliferation via microbial metabolites. BMC Microbiology, 20, 205.

+ Open protocol

+ Expand

Mouse Gut Microbiome Profiling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse stool samples were collected and DNA was extracted using bead beater disruption and phenol : chloroform separation followed by DNeasy Blood & Tissue Kit (Qiagen) as described before.^{23 (link), 25 (link)} The V1-V3 region hypervariable region of the 16S rDNA was amplified using primer pair 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 534R (5′-ATTACCGCGGCTGCTGG-3′). Both the forward and the reverse primers contained universal Illumina paired-end adapter sequences, as well as unique individual 4-6 nucleotide barcodes between PCR primer sequence and the Illumina adapter sequence to allow multiplex sequencing (Supplementary Table 5). PCR products were visualized on an agarose gel, before samples were purified using the Agencourt AMPure XP kit (A63881, Beckman Coulter) and quantified by qPCR with the KAPA Library Quantification Kit (KK4824, KAPA Biosystems). Equimolar amount of samples were then pooled and sequenced with an Illumina MiSeq.

Sun X., Winglee K., Gharaibeh R.Z., Gauthier J., He Z., Tripathi P., Avram D., Bruner S., Fodor A, & Jobin C. (2018). Microbiota-derived Metabolic Factors Reduce Campylobacteriosis in Mice. Gastroenterology, 154(6), 1751-1763.e2.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!