Gel logic 200 imaging system
The Gel Logic 200 Imaging System is a laboratory equipment designed for capturing and analyzing gel electrophoresis images. It features a high-resolution camera and specialized software for capturing, processing, and analyzing gel images.
Lab products found in correlation
43 protocols using gel logic 200 imaging system
Evaluating VEGF-siRNA Complexation in CRS
Episomal Plasmid Clearance in Clonal iPSCs
Primers used for PCR to assess pluripotency in clonal iPSC lines.
Primer Set | Forward (5′-3′) | Reverse (5′-3′) | Size (bp) |
---|---|---|---|
EBNA-1 | ATCGTCAAAGCTGCACACAG | CCCAGGAGGTCCCAGTAGTCA | 665 |
Β-actin | CCCAGGCACCAGGGCGTGAT | TCAAACATGATCTGGGTCAT | 178 |
Oct3/4 | CGTGAAGCTGGAGAAGGAGAAGCT | CAAGGGCCGCAGCTCACACATGTTC | 250 |
Nanog | CAGCCCCGATTCTTCCACCAGTCCC | CAGCCCCGATTCTTCCACCAGTCCC | 400 |
DMNT3B | TGCTGCTCACAGGGCCCGATACTTC | TCCTTTCGAGCTCAGTGCACCACAAAAC | 242 |
PODXL | TCCAGCCCCACAGCAGXATCAACTACC | CCGGGTTGAAGGTGGCTTTGACTGCTC | 226 |
Mating Type Determination by PCR
Mating Type Determination by PCR
Agarose Gel Electrophoresis of PCR Products
Fur-box binding activity assay
DNA Binding Activity Assay
Plasmid DNA Damage Analysis
After irradiation, loading buffer (0.25% bromophenol blue, 0.25% xylene cyanol, 30% glycerol 99% in water) was added to each solution immediately. To reveal specific DNA damages, irradiated mixtures were further incubated with an excess of DNA-repair enzyme (FPG, ENDO V or ENDO III) for 1h at 37 ºC, and loading buffer was then added to each solution. All the samples were loaded on a 0.8% agarose gel containing SYBR® Safe as nucleic acid stain. Electrophoresis was performed in Tris-acetate-EDTA (TAE) buffer (0.004 M Tris-acetate, 1 mM EDTA) at 100V for 1 h. Finally, the DNA bands were detected under irradiation with UV light and visualized using a Gel Logic 200 Imaging System (Kodak). The relative abundance of the supercoiled form (Form I) and the nicked relaxed form (Form II) was quantified by densitometry with the image analyzer software Quantity One (BIO RAD).
Torula Yeast RNA Stability Assay
Genotyping Transgenic Mice by PCR
Simple PCR reactions were carried out using DNA Amplitools Master Mix (Biotools, Madrid, Spain), specific primers (400 nM each) and 5 μL of genomic DNA in a final volume of 25 μL. Animals were genotyped using specific primers for P2X7REGFP Fw 5′-CCTACGGCGTGCAGTGCTTCAGC-3′ and Rv 5′-CGGCGAGCTGCACGCTGCGTCCTC-3′; primers for J20 Fw 5′-GGTGAGTTTGTAAGTGATGCC-3′ and Rv 5′-TCTTCTTCTTCCACCTCAGC-3′. PCR was carried out over 40 cycles of 94°C for 30 s, 60°C for 45 s, and 72°C for 45 s for EGFP primers or over 40 cycles of 94°C for 30 s, 60°C for 45 s, and 72°C for 45 s for J20 primers.
PCR amplification products were electrophoresed on a 1.5% (w/v) agarose gel and stained with SYBR® Safe DNA Gel Stain (Life Technologies, Carlsbad, CA, United States). PCR bands were visualized by gel imaging system Gel Logic 200 Imaging System (Kodak, Rochester, NY, United States).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!