The RNA was extracted following treatment of chondrocytes using the GeneJET RNA Purification Kit (Thermo Fisher Scientific). The cDNA was prepared using 0.5 µg RNA by TaqMan® Reverse Transcription Reagents (Thermo Fisher Scientific). Semiquantitative gene expression (qPCR) was done using TaqMan™ Gene Expression Assays (Thermo Fisher Scientific) and Roche LC480 instrument (Roche, Basel, Switzerland) for the following genes Aggrecan (ACAN), Collagen type II alpha 1 (COL2A1), SRY (sex-determining region Y)-Box 9 (SOX9), nuclear factor kappa B (NFκB), matrix metalloproteinase 13 (MMP13), tumor protein P53 (p53) and Caspase 3 (Casp3). To calculate the data as 2−(ΔΔCT), the expression levels of target genes were normalized to the housekeeping gene.35
Lc480 instrument
Manufactured by Roche
Sourced in Germany, France, China
The LC480 instrument is a laboratory equipment designed for real-time quantitative PCR (qPCR) analysis. It provides precise and reliable detection and quantification of nucleic acid sequences.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy kit, by Qiagen (3 mentions)
Rnase a, by Thermo Fisher Scientific (3 mentions)
Lightcycler 480 sybr green 1 master, by Roche (3 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (3 mentions)
Masterpure yeast rna purification kit, by Biosearch Technologies (3 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Kapa library quantification kit, by Roche (2 mentions)
Nextseq, by Illumina (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Taqman reverse transcription reagent, by Thermo Fisher Scientific (1 mentions)
Genejet rna purification kit, by Thermo Fisher Scientific (1 mentions)
Pcr machine, by Thermo Fisher Scientific (1 mentions)
Rnaeasy kit, by Beyotime (1 mentions)
Tb green fast qpcr mix, by Takara Bio (1 mentions)
Reveraid rt reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Reverse transcription system, by Promega (1 mentions)
30 protocols using lc480 instrument
1
Chondrocyte gene expression analysis
2
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer sequences (Supplementary Table S3 , Thermo Fisher Scientific, Waltham, NJ, USA) were selected based on the literature [111 (link),112 (link),113 (link),114 (link),115 (link),116 (link)], supplied by the Thermo Fisher Scientific, and diluted according to the manufacturer’s instructions using nuclease free water. For each qPCR reaction, 5 µL of EliZymeGreen MIX AddROX (Elisabeth Pharmacon, Brno, Czech Republic, Cat No. EZ4614), 1 µL of diluted forward, 1 µL of diluted reverse primers (to adjust a final concentration of oligonucleotides in the reaction mixture to 250 nM), and 2 µL of nuclease-free water were used. Diluted cDNA (1 µL; 20 µL cDNA:20 µL nuclease-free water) was added to the mixture. qPCR conditions for all listed primer pairs were the same: 1 min of initial denaturation (95 °C) followed by 35 cycles of 95 °C for 15 s, 57 °C for 15 s, and 72 °C for 15 s in 96-well optical reaction plates. Subsequently, a melting curve analysis was performed. All qPCR reactions were performed at Roche LC480® Instrument (Roche Diagnostics GmbH, Mannheim, Germany) in 3 technical replicates. RT-qPCR data were processed and normalized as described in Livak and Schmittgen (2001) [117 (link)]. Alpha tubulin was chosen as a reference gene. Differential expression was calculated relative to WM (white light medium irradiance).
3
Quantifying Prostate Cell Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative polymerase chain reaction (RT-qPCR) was used to measure the relative quantities of TP53, MDM2, and THBS1 mRNA levels between the control group and Cu B-treated group (12.5 nM, 25 nM, 50 nM) (n = 3). Total RNA from prostate cells was isolated with an RNAeasyTM kit (R0026, Beyotime Biotechnology, Shanghai, China). The concentration and purity of RNA samples were assessed using a spectrophotometer (ACT gene, Shanghai, China). cDNA was generated from 1 μg RNA on a PCR machine (Applied Biosystems, Shanghai, China) according to the procedures of the PrimeScript™RT Master Mix (Takara, Shanghai, China). Primer sequences were designed using premier primer 6, as shown in Table 1 . In order to measure mRNA expression, RT-qPCR analysis was performed using TB Green®Fast qPCR Mix (Takara, Shanghai, China). The mRNA levels were quantified using a Roche LC480 instrument (Roche, Basel, Switzerland). The relative gene expression was analyzed using the 2−∆∆Ct method.
4
Quantifying XIST Expression Using RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used the ReverAid RT reverse transcription kit (Thermo Fisher Scientific, Waltham, MA, USA) and random primers to reverse-transcribe the RNA to cDNA. The primers used for qPCR were designed using the Roche Universal Probe Library (Roche, Basel, Switzerland). qPCR was performed using the Roche LC-480 instrument (Roche, Basel, Switzerland). The reaction conditions were as follows: denaturation at 95 °C for 10 min annealing at 60 °C for 30 s, extension at 72 °C for 1 s, and for a total run of 60 cycles. For qPCR of GAPDH, we used probe no. 45, and for XIST, we used probe no. 32. The primer sequences were as follows: GAPDH forward: GAGTCCACTGGCGTCTTCAC; GAPDH reverse: GTTCACACCCATGACGAACA. XIST forward: TCGGAGAAGGATGTCAAAAGA; XIST reverse: TGCAGCGTGGTATCTTCAAT. Electrophoresis of the amplicons was performed using 4% agarose gels at 100 V.
5
Quantifying Key Biomarker mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of CD98hc, LAT1 and ARPP P0 mRNA expression in human cell lines, total RNA was extracted using the RNeasy Kit (QIAGEN). cDNA synthesis was performed using Superscript III (Life technologies). Quantitative PCR analysis (SYBR Green) was performed on the LC480 instrument (Roche) according to standard procedures. ARPP (acidic ribosomal phosphoprotein P0) was used as internal reference. Primer sequences were as follows:
LAT1: 5′- GAAGAGGCGCGGGAGAAG AT-3′ and 5′- GTTGAGCAGCGTGATGTT CC-3′; CD98hc: 5′- ATGGAGCTACAGCCTCCTGA-3′ and 5′- CGCGCTGAGACCCTGG −3′; ARPP: 5′-GCACTGGAAGTCCAACTACTTC-3′ and 5′-TGAGGTCCTCCTTGGTGAACAC-3′.
6
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect levels of gene expression, total RNA was prepared using TRIzol (Invitrogen) extraction followed by DNase (Ambion) treatment, and reverse transcribed with a Reverse Transcription System (Promega) following the manufacturer’s instructions. The resulting total cDNA was analyzed quantitatively using a FastStart Universal SYBR Green Master kit (Roche) with primers for KIT, ERK, AKT, PLCG, and DCT. Expression profiles were tested in triplicate on at least three mice on an LC480 instrument (Roche). Data were analyzed using the comparative Ct (ΔΔCt) method and one-tail, unpaired student T test (significance cutoff p < 0.01). Gene expression levels were normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
7
qRT-PCR analysis of oxidative stress response in C. glabrata
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C. glabrata cells were mock-treated or treated with phosphate starvation or 1.5 mM H2O2 for 45 minutes. ~2–4×107 cells were harvested by centrifugation, snap-frozen in liquid nitrogen and stored in −80 until RNA extraction. Two biological replicates were collected per condition. RNA was extracted using a MasterPure Yeast RNA purification kit (Biosearch Technologies, MPY03100). cDNA was synthesized using SuperScript™ III First-Strand Synthesis System (Invitrogen, 18080051) and treated with RNase A (ThermoFisher, EN0531). We used the LightCycler® 480 SYBR Green I Master (Roche, 04707516001) and qRT-PCR was performed on a Roche LC480 instrument. Three technical replicates were performed for each sample. The PCR program was 95°C for 5 minutes, followed by 45 cycles of 95°C for 10 seconds, 60°C for 20 seconds, and 72°C for 20 seconds. Data analysis was done using the instrument software, including automatic baseline subtraction and CT value quantifications. ACT1 was used as a reference gene and its CT values were subtracted from those of CTA1. We then subtracted the mean of the ΔCT for the mock-treated samples from the technical replicates for the phosphate starvation and H2O2-treated ones to obtain ΔΔCT, which were used for downstream analyses.
8
Quantitative Expression Analysis of Plant Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 50 mg of plant tissue per sample was taken for analysis and immediately frozen in liquid nitrogen. Homogenization using mortar and pestle followed. Resulting soft powder was washed into nuclease-free Eppendorf tube by adding 500 µL of TRIzol (Sigma Aldrich, St. Louis, MO, USA Cat No. T9424), and further processed as described in [45 (link)] using Turbo DNAse Free TM kit (Ambion, Austin, TX, USA, Cat No. AM 1907) to get rid of DNA traces and First Strand cDNA kit (Thermo Scientific, Waltham, NJ, USA, Cat No. K1612) for reverse transcription. qPCR reaction followed as described in [45 (link)] using EliZyme Green mix Add ROX (Elisabeth Pharmacon, Brno, Czech Republic, Cat No. EZ4614) and primer sequences (Thermo Fisher Scientific, Waltham, NJ, USA) from the available literature [70 (link),71 (link),72 (link),73 (link),74 (link),75 (link)]. cDNA was subjected to amplification by the LC480 Instrument (Roche Diagnostics GmbH, Mannheim, Germany). Gained data were processed as described in Livak and Schmittgen (2001) [76 (link)]. Alpha tubulin was chosen as reference gene and differential expression was calculated relative to LI NT treatment.
9
Quantifying HBV Capsid-Associated DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HBV capsid-associated DNA was extracted from the cells as described previously, with modifications64 (link). Equivalent amounts of HepG2 cells were homogenized in 1 ml lyses buffer (50 mM Tris, pH7.5, 0.5% Nonidet P-40, 1 mM EDTA, and 100 mM NaCl) and mixed gently at 4 °C for 1 h. Next, 10 μl of 1 M MgCl2 and 10 μl of 10 mg/ml DNase were added and incubated for 2 h at 37 °C. Viral cores were precipitated by adding 35 μl of 0.5 M EDTA and 225 μl of 35% polyethylene glycol and incubated at 4 °C for 30 min. They were then concentrated by centrifugation, and the pellets were resuspended in 10 mM Tris, 100 mM NaCl, 1 mM EDTA, 1% SDS, and 20 μl proteinase K (25 mg/ml) and incubated overnight. Viral DNA released from the lysed cores was extracted with phenol and chloroform, precipitated with isopropanol, and resuspended in Tris-EDTA. Resuspended HBV capsid-associated DNA was quantified by real-time PCR as described by the manufacturer (PG Biotech, Shenzhen, China). Primers used in real-time PCR were as follows: P1, 5′-ATCCTGCTGCTATGCCTCATCTT-3′ and P2, 5′-ACAGTGGGGAAAGCCCTACGAA-3′. The probe was 5′-TGGCTAGTTTACTAGTGCCATTTTG-3′. PCR was carried out and analyzed using a Roche LC480 instrument.
10
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CD31+CD45low cells were isolated by FACS as described above, and RNA was isolated using a Qiagen RNeasy kit.
Following DNase digestion, RNA was reverse transcribed to cDNA using a Maxima first-strand cDNA synthesis kit (Thermo Fisher Scientific, K1671). For each experiment, an equal quantity of input RNA was used for each sample for the cDNA reaction. qRT–PCR reactions were run in triplicate with Power SYBR Green PCR master mix (Life Technologies, 4368708) on an LC480 instrument (Roche). The relative expression changes were normalized to Rplp0. For heart EC samples, the Rplp0-set 2 primers were used. The full list of primers is provided in Supplementary Table9 .
Following DNase digestion, RNA was reverse transcribed to cDNA using a Maxima first-strand cDNA synthesis kit (Thermo Fisher Scientific, K1671). For each experiment, an equal quantity of input RNA was used for each sample for the cDNA reaction. qRT–PCR reactions were run in triplicate with Power SYBR Green PCR master mix (Life Technologies, 4368708) on an LC480 instrument (Roche). The relative expression changes were normalized to Rplp0. For heart EC samples, the Rplp0-set 2 primers were used. The full list of primers is provided in Supplementary Table
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!