Pmir report luciferase reporter plasmid

The target genes and the binding sites of miR-19-3p were predicated with TargetScan software (TargetScanHuman 7.1). According to the results of the target genes predicted by bioinformatics software, luciferase activity assay was performed for further confirmation according to the protocols.^{18 (link)} In brief, the wild-type (WT, UCUACCUCAAAGACCUUUGCACA) and mutant miR-19-3p binding regions in the 3′-UTR of fas gene (UCUACCUCAAAGACCCAAUUCGC) were cloned into pMIR-REPORT luciferase reporter plasmids (Promega Corporation, Madison, Wisconsin). Micro RNA-19-3p mimic, inhibitor, and negative control were co-transfected into HCT116 cells with luciferase reporter plasmids. The cells were cultivated at 37°C, 5% CO₂ condition for 24 hours, followed by the fluorescence intensity measurement using GloMax20/20 illuminometer (Promega Corporation). All experiments were performed in triplicate.

The wild-type (WT) and mutant 3′-untranslated region (UTR) of CASP2 containing the seed regions of miR-182-5p were chemically synthesized in vitro and cloned into the pMIR-REPORT luciferase reporter plasmid (Promega Corporation, Madison, WI, USA) between the Spe-1 and Hind III restriction sites. 293T cells (Cell Bank, Chinese Academy of Sciences, Shanghai, China) were subsequently co-transfected with agomiR-182-5p (100 nM; forward, 5′-UUUGGCAAUGGUAGAACUCACACU-3′; reverse, 3′-AAACCGUUACCAUCAAGAGUGUGA-5′; Sangon Biotech Co., Ltd.) and the WT or mutant 3′-UTR CASP2 luciferase reporter plasmids (0.8 µg). 293T cells were transfected with agomiR-negative control (NC; forward, 5′-UUCUCCGAACGUGUCACGUTT-3′; reverse, 3′-TTAAGAGGCUUGCACAGUGCA-5′; Sangon Biotech Co., Ltd.) as a control. Following 24-h transfection, cells were lysed and luciferase activities were measured using the Dual-Luciferase Reporter Assay system (Promega Corporation) according to the manufacturer's protocol and luciferase activity was detected using a GloMax 20/20 luminometer (Promega Corporation). Firefly luciferase activity was normalized to Renilla luciferase activity and each experiment was performed in triplicate.

PTEN 3′-untranslated region (UTR) sequences with wild-type and mutant seed regions for miR-26a were synthesized by Sangon, Shanghai, China, with the addition of Spe-1 and HindIII restriction sites at both ends. These two DNA fragments were cloned into the pMIR-REPORT luciferase reporter plasmid (E1980; Promega, Madison, WI, USA), and 0.8 µg plasmids carrying the wild-type and mutant 3′-UTR sequences, respectively, were transfected into 293T cells (Cell Bank, Chinese Academy of Sciences, Shanghai, China), using liposomes, followed by transfection with 100 nM agomiR-26a (Sangon Biotech). After 24 hours, the cells were lysed and luciferase was determined using a GloMax 20/20 luminometer (Promega), with Renilla luciferase as an internal reference.