Screenfect a

A549 cells derived from human lung adenocarcinoma (RIKEN BRC through the National Bio-Resource Project of the MEXT, Ibaraki, Japan) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Sigma-Aldrich, St. Louis, MO, USA) supplemented with 5% fetal bovine serum (FBS, Biological Industries, Israel) as described previously [41 (link)]. In two-dimensional (2D) and three-dimensional (3D) models, the cells were grown on flat-bottomed and PrimeSurface 96U plates (Sumitomo Bakelite, Tokyo, Japan), respectively. CLDN2 promoter construct and internal control pRL-TK vector were transfected into the cells using HilyMax (Dojindo Laboratories, Kumamoto, Japan). The pTRE2 (mock) and CLDN2/pTRE2 mammalian expression vectors were transfected into spheroid cells using ScreenFect A (Fujifilm Wako Pure Chemical Industries).

Transient transfection of siRNAs was performed using ScreenFect A (Wako) according to manufacturer’s instructions. Concentrations of siRNA for control, ABCB1, ABCC1 and ABCG2 were set at 20 nM. Control siRNA was purchased from Integrated DNA Technologies (NC1). Sense strand sequence of the siRNAs for ABCB1, ABCC1 and ABCG2 are as follows:
ABCB1 #1 (5′-GAGCUUGAAAGGUACAACAAAAAdTdT-3′),
#2 (5′-GAUGAAGCUACAUCAGCUCUAGAdTdA-3′);
ABCC1 #1 (5′-CAAACAGCAUCACCGUGAAAAACdGdC-3′),
#2 (5′-CUGGAAGAAGGAAUGUGCCAAAUdCdC-3′);
ABCG2 #1 (5′-CAUGAAUAUAUCAGUGGAUACUAdCdA-3′),
#2 (5′-GGAGAAGAAUUCUUGAUAAAGCAdGdG-3′).

The Cas9 nuclease expression vector was generated as follows. The hygromycin B resistance gene cassette was prepared by PCR amplification using primer pair Hyg SS and Hyg AS (Table S1). pGloSensor™-22F cAMP Plasmid (Promega corporation, Madison, Germany) was used as the template. The PCR product was phosphorylated and inserted into pCS2+hSpCas9 (Addgene Plasmid 51815), which had been digested with Mfe I, filled in by Klenow fragment, and dephosphorylated. The resultant vector, pCS2+hSpCas9/Hyg, was used for knockout experiments. The sgRNA expression vector was generated according to the previous method described in [18 (link)]. Briefly, a pair of oligonucleotides was annealed and ligated into pDR274 (Addgene Plasmid 42250), which had been digested with Bsa I. The resultant vector, pDR274-CDK9, was used for KO experiments. A combination of pDR274-CDK9 and pCS2+hSpCas9/Hyg, or pDR274-Mock and pCS2+hSpCas9/Hyg, was co-transfected into OLHNI-2 cells stably expressing medaka Pgr using ScreenFect A (Wako) according to the manufacturer’s instructions. After culture for 48 h, the medium was changed into fresh medium containing 100 μg/mL hygromycin (Wako), and cells were cultured for another 48 h. The cells were harvested and used for the immunoprecipitation/Phos-tag SDS-PAGE analysis.

The siRNAs against human NIPAL4 were transfected into the cells using ScreenFect A (Fujifilm Wako Pure chemical). Mission siRNA Universal Negative Control (Sigma-Aldrich) was used as a negative control. Cells were collected after three days of transfection. The GLuc-ON Promoter Reporter vectors for human HAS2 and HAS3 were transfected into the cells using HilyMax (Dojindo Laboratories, Kumamoto, Japan). The mutants of putative CREB-binding sites of promoter region in HAS2/3 were constructed using a KOD-Plus Mutagenesis kit (Toyobo, Osaka, Japan) and primer pairs as described in Table 1. Transfection efficiency was corrected by secreted alkaline phosphatase (SEAP) reporter gene assay. The activities of secreted luciferase and SEAP were measured using a Ready-To-Glow Dual Secreted Reporter Assay kit (Takara Bio, Shiga, Japan).

A plasmid containing full-length mouse SLPI cDNA was purchased from DNAFORM. The open reading frame corresponding to SLPI with a fused 6× His-Tag at the C-terminal was amplified from a plasmid and cloned into pcDNA3.1 (Thermo Fisher Scientific). The primers were as follows: mouse SLPI forward, 5′-CCCCCGAATTCGAGAGCTCC-3′, and reverse, 5′-CACCGAGCATCTA GACTAGTGGTGATGGTGATGGTGATGATGACGACCTTCGATCATCGGGGGCA-3′. Plasmid transfection was performed using ScreenFect A (Wako), in accordance with the manufacturer’s instructions. Briefly, cells were seeded at 2 × 10⁶ cells/ml and transfected of Slpi plasmid DNA (0.3 µg) with ScreenFect A. The mRNA of Slpi and Mmp9 were analyzed 1 day after transfection.

Regarding the KD of Keap1 and Sp1 using shRNA, specific target regions of Keap1 and Sp1 were designated and inserted into the pBAsi-hU6 Neo Vector (Takara Bio Inc) according to a previously described procedure (27 (link), 55 (link)). The target sequence for Keap1 KD was 5′-GCAGGCCTTTGGCATCATGAACG-3′ and the target for Sp1 was 5′-AATGCCAATAGCTACTCAACT-3′. The nucleotide sequence for control shRNA against GFP was 5′-CTCGAGTACAACTATAACTCA-3′. In the KD of WDR23, siRNA against WDR23 (Cat. No. SI05029899) with the target sequence of 5′-CUGGGUCUUUAGGGUAGGACA-3′ was purchased from Qiagen. AllStars Negative Control (SI03650318, Qiagen) was used as control siRNA. shRNA and siRNA were transfected into cells using ScreenFect A (Wako) according to the manufacturer's instructions. Transfectants of shRNA-Mock, shRNA-Keap1, or shRNA-Sp1 were selected using G418.