Total RNA was extracted using Trizol reagents solution (Sigma). Reverse transcription (RT) and cDNA amplification were carried with 2 μg of total RNA using a Thermo-Scientific cDNA synthesis kit (Thermo-Scientific, Waltham, MA, USA,) according to the manufacturer's instructions. The cDNA obtained was amplified with the following primer: tyrosinase, forward 5′-ATGGGTCAACACCCATGTTT-3′ and reverse 5′-GGCAAATCCTTC CAGTGTGT-3″; melanogenesis-associated transcription factor (MITF), forward 5′-CGGGATGCCTTGTTTATGGT-3′ and reverse 5′-TGCCTCTGAGCTTGCTGTAT-3′. The reaction was cycled 25 times, for 30 s at 95°C, 30 s at 58°C, and 60 s at 72°C. The amplified RT-polymerase chain reaction (PCR) products were analyzed on 0.8% agarose gels, visualized by ethidium bromide staining, and photographed under ultraviolet light. The quantitative real-time PCR was performed using an R-Corbett Rotor-Gene Model 6000 (Sydney, Australia), with SYBR Green qPCR Super Mix UDG kit (Invitrogen, Carlsbad, CA, USA). The relative expression levels of the target genes against (GAPDH) as reference gene were calculated using the delta cycle threshold (Ct) method [25] (link).
Sybr green qpcr supermix udg kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The SYBR Green qPCR SuperMix-UDG kit is a ready-to-use solution for quantitative real-time PCR (qPCR) applications. It contains SYBR Green I dye, a DNA-binding fluorescent dye, and uracil-DNA glycosylase (UDG) for carryover contamination prevention.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Abi prism 7300 system, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Abi prism 7700, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Abi prism 7300 detection system, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Steponeplus rt pcr system, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Promega (1 mentions)
Total rna miniprep kit, by Merck Group (1 mentions)
Bca protein assay kit, by Promega (1 mentions)
Trizol plus rna purification kit, by Thermo Fisher Scientific (1 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Abi 7500 system, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Lightcycler 96 system, by Roche (1 mentions)
11 protocols using sybr green qpcr supermix udg kit
1
Quantitative Assessment of Melanogenic Markers
2
Quantification of NOX5 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from RPT cells with the RNeasy Mini Kit (Qiagen Inc., Valencia, CA) and reverse transcription (RT) was performed using M-MLV reverse transcriptase (Invitrogen). Two micro liters of the RT product was used for real-time PCR (SYBR Green qPCR Supermix UDG Kit, Invitrogen): 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 63 °C for 60 s. The human NOX5 primers were 5׳-AACTTCTGGAAGTGGCTGCT-3׳ (sense, nt #1251-71), and 5׳-GAGGAGATGAGTGACCTTGGA-3׳ (antisense, nt # 1376-86). Human GAPDH primers were 5׳-GTCGTGGAGTCTACTGGCGTCTT-3׳ (sense), and 5׳-CAGTCTTCTGAGTGGCAGTGATGG-3׳ (antisense). Expression of the target gene was normalized against the expression of GAPDH (ABI Prism 7700 sequence detector system, Applied Biosystems, SDS (Ver. 1.91, Foster City, CA).
3
Quantitative Analysis of Inflammatory Gene Expression in Nasal Epithelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from NECs was extracted using Trizol reagent (Invitrogen, CA, USA) and purified by the RNeasy kit (Qiagen Inc, CA, USA) according to the manufacturer’s instructions. Then, reverse-transcription of total RNA was performed by SuperScript III Reverse Transcriptase (Invitrogen, CA, USA). Then, the qRT-PCR was implemented on the ABI Prism 7300 Detection System (Applied Biosystems, CA, USA) by the SYBR Green qPCR Super Mix-UDG kit (Invitrogen, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for internal calibration. The comparative 2−ΔΔCt method was used to calculate the relative mRNA expression. Primer sequences were displayed in Table 1 .
Primer sequences for quantitative real-time RNA
| Genes | Forward primer | Reverse primer |
|---|---|---|
| CXCL11 | 5ʹ-ATGAGTGTGAAGGGCATGGC-3’ | 5ʹ-TCACTGCTTTTACCCCAGGG-3’ |
| CXCL2 | 5ʹ-GCTGCTGCTCCTGCTTCTAGTG-3’ | 5ʹ-AGGTGAATTCCTTGCACGGTCTG-3’ |
| CCL3 | 5ʹ-CATGGCGCTCTGGAACGAA-3’ | 5ʹ-TGCCGTCCATAGGAGAAGCA-3’ |
| TNF | 5ʹ-GCACTGAGAGCATGATCCGAGAC-3’ | 5ʹ-CGACCAGGAGGAAGGAGAAGAGG-3’ |
| IL-1B | 5ʹ-AAGTGATGGCTAACTACGGTGACAAC-3’ | 5ʹ-GCTTCTCCACTGCCACGATGAC-3’ |
| IL-18 | 5ʹ-GCTTGAATCTAAATTATCAGTC-3’ | 5ʹ – GAAGATTCAAATTGCATCTTAT-3’ |
| MUC5AC | 5ʹ-CGACAACTACTTCTGCGGTGC-3’ | 5ʹ-GCACTCATCCTTCCTGTCGTT-3’ |
| NF-κB | 5ʹ-AGCACCAAGACCGAAGCAA-3’ | 5ʹ-TCTCCCGTA ACCGCGTAGTC-3’ |
| GAPDH | 5ʹ-CAACTTTGGCATTGTGGAAGG-3’ | 5ʹ-ACACATTGGGGGTAGGAACAC-3’ |
4
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from livers and cultured cells using TRIzol reagent (Invitrogen, 15596018) according to the manufacturer’s instructions and quantified with the use of the Nanodrop ND-2000 system. 5 µg total RNA was used to synthesize first-strand complimentary DNA (cDNA) using reverse transcription kit (Promega, WI, USA). The cDNA was then diluted and used as the template for the detection of the different transcripts. The expression levels were analyzed by quantitative real-time polymerase chain reaction (RT-PCR) on Step One Plus RT-PCR system (Applied Biosystems, USA) using SYBR Green qPCR SuperMix-UDG kit (Invitrogen). RT-PCR was performed for 3 min at 95°C, and a total of 40 cycles of 10 s at 95°C, 20 s at 60°C, and 30 s at 72°C. The ratio of the expression levels of tested genes were analyzed according to the 2−ΔΔCT method and normalized to mRNA levels of Actin. The sequences of the primers, as synthesized by Invitrogen, are shown in Table S1
5
Quantitative Analysis of Gene and Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a total RNA miniprep kit (Sigma) and digested with DNase I. cDNA was synthesized using oligo-dT and random hexamer primers for SYBR Green qPCR supermix-UDG kit (Invitrogen, Carlsbad, USA) analysis according to the manufacturer’s protocols. Triplicate biological samples were obtained for PCR analysis. PCR primers were designed and checked using LAST (NCBI), and PCR products were limited to 100–200 bp in length.
Proteins were extracted from treated cells and total protein was quantified using the BCA protein assay kit (Promega, USA). Equal protein amounts were separated via SDS-PAGE, transferred onto nitro-cellulose membranes, blocked, and incubated overnight with monoclonal antibodies. After washing, membranes were incubated with an HRP-conjugated secondary antibody for 2 h at room temperature. Bands were visualized using the Westzol enhanced chemiluminescence kit (Intron, Sungnam, Korea) and expression was normalized to the housekeeping gene.
Proteins were extracted from treated cells and total protein was quantified using the BCA protein assay kit (Promega, USA). Equal protein amounts were separated via SDS-PAGE, transferred onto nitro-cellulose membranes, blocked, and incubated overnight with monoclonal antibodies. After washing, membranes were incubated with an HRP-conjugated secondary antibody for 2 h at room temperature. Bands were visualized using the Westzol enhanced chemiluminescence kit (Intron, Sungnam, Korea) and expression was normalized to the housekeeping gene.
6
Comparative Analysis of ESRP1 Expression in Breast Cancer and Normal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MCF-7 cells (human BC cells) were acquired from the Shanghai branch of the Chinese Academy of Sciences and grown in culture medium consisting of RPMI-1640 and 10% fetal bovine serum. MCF-10A cells (human normal breast epithelial tissue cells) were purchased from Shanghai Biotechnology Co., Ltd., enzyme research and grown in culture medium consisting of DMEM/F12 and 5% horse serum, 10 mg/mL insulin, 20 ng/mL EGF, 0.5 mg/mL hydrocortisone, and 100 ng/mL cholera toxin. We also bought reagents from Shanghai Biotechnology Co., Ltd., enzyme research. The cell culture conditions were 37°C and 5% carbon dioxide.
The total RNA of the MCF-7 and MCF-10A cell lines was extracted with a TRIzol™ Plus RNA Purification Kit (Invitrogen, 12183555). RNA was reverse-transcribed into cDNA using a SuperScript™ III First-Strand Synthesis SuperMix kit for reverse transcription-polymerase chain reaction (RT-PCR) (Invitrogen, 11752050). Next, real-time quantitative PCR (qPCR) was performed using a SYBR Green qPCR SuperMix-UDG kit (Invitrogen, 11733046). The primers used in qPCR for human ESRP1 (GeneBank accession No. NM--001034915) were forward 5′-CATGTACGTTGCTATCCAGGC-3′ and reverse 5′-CTCCTTAATGTCACGCACGAT-3′ (synthesized by Sangon Tech).
The total RNA of the MCF-7 and MCF-10A cell lines was extracted with a TRIzol™ Plus RNA Purification Kit (Invitrogen, 12183555). RNA was reverse-transcribed into cDNA using a SuperScript™ III First-Strand Synthesis SuperMix kit for reverse transcription-polymerase chain reaction (RT-PCR) (Invitrogen, 11752050). Next, real-time quantitative PCR (qPCR) was performed using a SYBR Green qPCR SuperMix-UDG kit (Invitrogen, 11733046). The primers used in qPCR for human ESRP1 (GeneBank accession No. NM--001034915) were forward 5′-CATGTACGTTGCTATCCAGGC-3′ and reverse 5′-CTCCTTAATGTCACGCACGAT-3′ (synthesized by Sangon Tech).
7
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The knockdown or overexpression efficiency was determined by quantitative real time PCR at 24 h after transfection. Total RNA was extracted using the Trizol reagent (Invitrogen, USA).Real-time quantitative PCR (qRT-PCR) was performed using a SYBR green qPCR SuperMix-UDG kit (Life Technologies, USA) on an ABI PRISM 7300 system (Applied Biosystems). Ct values of mRNA were normalized to β-actin. Relative expression was calculated using the ΔΔCt method.
8
Quantifying mRNA Expression in Liver Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from HepG2 and HepG2/ADR liver cancer cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. RNA concentration was determined using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). According to the manufacturer's instructions, a total of 1 µg RNA was reverse-transcribed (at 42°C for 1 h; and at 70°C for 10 min) using the First-Strand cDNA Synthesis kit (Invitrogen; Thermo Fisher Scientific, Inc.). qPCR was performed using a SYBR green qPCR SuperMix-UDG kit (Life Technologies; Thermo Fisher Scientific, Inc.) on an ABI 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.) to determine the expression levels of the target mRNAs in accordance with the manufacturer's instructions (95°C for 10 sec; 60°C for 15 sec; 72°C for 15 sec; 45 cycles).
Relative mRNA expression levels were calculated using GAPDH as the internal control. Each sample was run in triplicate. The primer pairs used were as follows: P4HB forward, 5′-GGAATGGAGACACGGCTTC-3′ and reverse, 5′-TTCAGCCAGTTCACGATGTC-3′; and β-actin forward, 5′-AGCGCGGCTACAGCTTCA-3′, and reverse, 5′-GGCCATCTCTTGCTCGAAGT-3′. The gene expression levels for all samples were normalized to GAPDH expression using the 2−ΔΔCq method (30 (link)). At least three independent experiments were performed.
Relative mRNA expression levels were calculated using GAPDH as the internal control. Each sample was run in triplicate. The primer pairs used were as follows: P4HB forward, 5′-GGAATGGAGACACGGCTTC-3′ and reverse, 5′-TTCAGCCAGTTCACGATGTC-3′; and β-actin forward, 5′-AGCGCGGCTACAGCTTCA-3′, and reverse, 5′-GGCCATCTCTTGCTCGAAGT-3′. The gene expression levels for all samples were normalized to GAPDH expression using the 2−ΔΔCq method (30 (link)). At least three independent experiments were performed.
9
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol Reagent (Cat#15596‐018, Life Technologies, USA) following the manufacturer's instructions. Real time quantitative PCR (M‐MLV Reverse Transcriptase kit, Life Technologies, USA) was performed using a SYBR Green qPCR SuperMix‐UDG kit (Life Technologies, USA) with a LightCycler 96 system (Roche, Switzerland). Wistar rats were used as the controls and β‐actin (actb) was used as a an internal reference (measured with the 2−ΔΔCt method).
10
Quantifying miRNA-142-3p and HMGB1 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from A549 cells using an RNeasy Mini Kit (Qiagen, USA) following manufacturer's instructions. The RT primers for miRNA cDNA synthesis are: MiR-142-3p, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCATAAA; U6, CGAGCACAGAATCGCTTCACGAATTTGCGTGTCAT. The primers for mRNA detection are: miR-142-3p, 5'-GTCGTATCCAGTGCAGGG-3'(forward) and 5'-CGACGTGTAGTGTTTCCTA-3' (reverse); HMGB1, 5'-GATGGGCAAAGGAGATCCTA-3' (forward) and 5'-CTTGGTCTCCCTTTGGGG-3' (reverse). Real-time quantitative PCR (qRT-PCR) was performed using a SYBR green qPCR SuperMix-UDG kit (Life Technologies, USA) on an ABI PRISM 7300 system (Applied Biosystems). Ct values of HMGB1 mRNA were normalized to β-actin. Relative expression was calculated using the ΔΔ Ct method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!