The largest database of trusted experimental protocols

13 protocols using transit lt1 transfection reagent

1

Generating IFN-β Responsive Reporter Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
Briefly, 293T cells (ATCC, Cat# CRL-3216) were transfected with 1 µg pGL4.45[luc2P/ISRE/Hygro] Vector with TransIT-LT1 Transfection Reagent (TaKaRa, Cat# V2304T) in Opti-MEM (Thermo Fisher Scientific, Minoto-Ku, Japan, Cat# 31985062). After 3 d, the cells were cultured in 250 µg/mL of hygromycin B (Nacalai Tesque, Cat# 09287-84) for 10 d. Single-cell cloning was then performed. After cell growth, we evaluated the induction of luciferase activity upon treatment with recombinant human IFN-β (PeproTech, Cranbury, NJ, USA, Cat# 300-02BC) in each clone.
+ Open protocol
+ Expand
2

Construction of EGFP-tagged Golgi Enzyme Reporter

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cDNA corresponding to the amino acid sequence from the N-terminal methionine to the position of 60 of β-1, 4-galactosyltransferase 1 gene (NP_071641), where a Golgi-localization signal exists (Cole et al., 1996), was amplified with a mouse heart cDNA library as a template (sense primer 640U: 5-GATCGCTGTGGTCGGGTAG-3, antisense primer 1071L: 5-GCACTGGCAACGAAGACAAG-3). Also, the full-length coding region of EGFP was amplified (sense primer 1U: 5-ATGGTGAGCAAGGGCGAGGAG-3, antisense primer 720L with termination codon: 5-TTACTTGTACAGCTCGTCCATGC-3). Both DNA fragments were fused by the overlap extension PCR [25 (link)] and cloned into the pTA2 vector (TOYOBO). After adding HindIII and BamHI sites by PCR, the fused fragment was further cloned into the same site of eukaryotic expression vector pCAG-MCS2 [26 (link)], which was provided by Dr. Mikio Hoshino. The plasmid was transfected into CHO cells using TransIT®-LT1 Transfection Reagent (Takara, V2300), and transformants were selected in 10% FBS-DMEM with 500 μg/ml G418. EGFP-tagged Golgi-positive colonies were selected via the observation of the fluorescent distribution, which was the same as that of the CHO cells transiently transfected with CellLight Golgi-GFP BacMam 1.0 (ThermoFisher, C10592). A positive clone, termed as CHO-GolEGF, was used from here onward.
+ Open protocol
+ Expand
3

Dual-Luciferase Assay for Transcriptional Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
CHO and HepG2 cells were transfected with the indicated pBIND vector together with the pG5luc reporter plasmid (Promega) which contains five GAL4 binding sites upstream of a minimal TATA box using TransIT LT-1 transfection reagent (Takara). At 24 hours after transfection, the cells were harvested and plated in a 96-well tissue culture plate. The cells were subsequently treated with each compound and, after 24 hours of treatment, were lysed in lysis buffer (Promega) and analyzed using the Dual-Luciferase® Reporter Assay System (Promega). The Firefly luciferase signal was normalized to the Renilla luciferase signal.
+ Open protocol
+ Expand
4

Estrogen Receptor Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were cultured in steroid-depleted medium for three days and seeded in 6-cm dishes (10,000 cells/dish). Twenty-four hours after seeding, cells were transfected with a plasmid encoding a luciferase reporter driven by the estrogen response element or pRL-tk-luciferase in medium containing TransIT LT-1 transfection reagent (TaKaRa). Forty-eight hours after transfection, luciferase activity was measured in triplicate using a luciferase assay system (Promega, Madison, WI, USA).
+ Open protocol
+ Expand
5

Lenti-X 293T Cell Transduction and TRIM5 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lenti-X 293T cells were co-transfected with pDON-5 Neo plasmids encoding each TRIM5 molecule, pGP packaging plasmid (TaKaRa, Cat# 6160), and pMD2.G plasmid with TransIT-LT1 Transfection Reagent (TaKaRa, Cat# V2300) in Opti-MEM. The supernatant was filtrated 2 days after transfection. The collected retroviral vectors were used to infect CRFK cells. The cells were cultured in the presence of 500 µg/mL G-418 (Nacalai Tesque, Cat# 09380–44) for 6 days. Then, single-cell cloning was performed, and the expression of TRIM5 in each clone was evaluated by Western blotting.
+ Open protocol
+ Expand
6

Retroviral Infection and Rescue in MEFs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Infection of MEFs with retrovirus (mock or Cre) was performed as described previously [59]. Retroviruses (mock and Cre) were produced by transfecting Plat-E packaging cells with 2 μg empty pMX-puro plasmid or 2 μg pMX-puro-Cre plasmid [25] using TransIT-LT1 transfection reagent (Takara). Two days after transfection, cell culture supernatants containing the retroviruses were filtered (MILLEX GV 0.22 μm, Millipore) and polybrene (0.5 μg/mL, Sigma) was added. The resultant viral solutions were used for infection of MEFs that were seeded at 8.5 × 105 cells per 10 cm dish the day before infection. Two days after retroviral infection, cells were diluted following trypsinization and cultured in the presence of puromycin (1 µg/mL) for additional 2 days to select infected cell populations and subsequently used for analyses. In the series of rescue experiments: CNOT7-WT, CNOT7-mutants (from T. Fujiwara) and CNOT6L [29] cDNA fragments were inserted into pMX-vectors and used for retrovirus production and subsequent infection to MEFs. Adenovirus infection [control (GFP) and Cre] was performed 2 days after retrovirus infection at MOI 7.5. Two days later, adenovirus-infected MEFs were used for immunoprecipitation. For cell death analysis, MEFs were cultured in the presence of puromycin (1 µg/mL) for additional 2 days.
+ Open protocol
+ Expand
7

Myod1 and Myog Promoter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 1.47 kb DNA fragment of the Myod1 gene (−1264 to +210 from the transcriptional start site at +1) or the 1.55 kb DNA fragment of the Myog gene (−1512 to +34 from the transcriptional start site at +1) were amplified by PCR (primer sets are shown in S3 Table) from L6 genomic DNA, and they were subcloned into the luciferase reporter plasmid pGL4.16 (Promega, Madison, WI, USA) (designated pGL4.16-Myod1 Pro1474 or pGL4.16-Myog Pro1546). L6 cells were seeded on culture flasks, and cultured in growth medium for a day. Then reporter constructs were transiently transfected into L6 cells using TransIT®-LT1 Transfection Reagent (TaKaRa Bio, Inc., Shiga, Japan). The renilla luciferase vector (pRL-SV40, Promega) was used as a transfection efficiency control. After incubation for a day, growth medium was replaced with differentiation medium and incubated for one more day under 1 G or 10-3G conditions. Luciferase luminescence was measured using a single-sample luminometer, the Biolumat LB 9505 (BERTHOLD TECHNOLOGIES GmbH & Co. KG, Bad Wildbad, Germany) with the Dual-Luciferase Reporter Assay System (Promega). Promoter activities were calculated as the ratio of firefly to renilla luciferase readings, and the averages of at least three independent experiments were calculated. Methods were approved by a Hiroshima University Gene Recombination Experiment Safety Committee.
+ Open protocol
+ Expand
8

Stable AQP8 Knockdown and Overexpression in 3T3-L1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To obtain stably AQP8-knocked down cells, 3T3-L1 cells were transfected with a plasmid producing short hairpin RNA targeting AQP8. The plasmid was designed on pBAsi-mU6 Neo vector by TaKaRa and the target sequence was CTATCGGTCATTGAGAATA. As the negative control cells, 3T3-L1 cells were transfected with a plasmid including a nonsense sequence, TCTTAATCGCGTATAAGGC. Cells were seeded in 6-well plates two days before transfection. For each well containing the cells in about 60% confluency, 3 µg of the plasmid DNA in TransIT-LT1 Transfection reagent (TaKaRa) was added. Stably knocked down cells were selected by culturing in the presence of 3.5 mg/ml of G418, a neomycin analog (Geneticin, GIBCO) and maintained with 1.0 mg/ml of G418. For AQP8-over expressed cells, 3T3-L1 cells were transfected with a pcDNA3.1(+) vector carrying mouse AQP8 cDNA and the cells stably expressing AQP8 were selected as described above.
+ Open protocol
+ Expand
9

Lentiviral Knockdown of Catecholamine Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
For RNAi experiments, we prepared shRNA expressing lentivirus particles as previously described.
20 Briefly, 293FT cells (Thermo Fisher Scientific) were transfected with the pLKO.1‐puro‐shRNA expressing vector, psPAX2, and pMD2.G (Addgene) using TransIT‐LT1 Transfection Reagent (TaKaRa Bio) and Opti‐MEM (Thermo Fisher Scientific). The virus‐containing medium was harvested 60 h after transfection. The following are the target sequences of RNAi used in this study: Human TH#1, GACGTACCAGTCAGTCTACTT; Human TH#2, GTTCGGGCTGTGTAAGCAGAA; Human DDC#1, GCTGGCCTGATTCCTTTCTTT; Human DDC#2, CGACGTTGAGAAGATAATCAT; Human DBH#1, GCGGGTGCCGCTTAAACATTT; Human DBH#2, CTTCAACCGCGACGTACTGAA; Human PNMT#1, GAGGACATCACCATGACAGAT; Human PNMT#2, GCACCCTCATCGACATTGGTT; Human VMAT1#1, GCGTACCTAGTGGAATAGCAT; Human VMAT1#2, GCTGGCTTTGTTATCATGTTT; Human VMAT2#1, GCTCTTCTGGGAATGATAATT; Human VMAT2#2, GGATCACAACTGCCCTATTAA; and Control, CCTAAGGTTAAGTCGCCCTCG.
+ Open protocol
+ Expand
10

Wnt3a Pathway Activation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
T‐cell factor reporter plasmid TOPFLASH (Upstate Biotechnology) and Renilla luciferase control reporter plasmid (pRL‐TK, Promega) were co‐transfected into tumor cells plated in 24‐well plates using TransIT‐LT1 transfection reagent (TaKaRa Bio) in accordance with the manufacturer's instructions. Wnt3a (50 ng/mL) was added 24 h later and the cells were cultured for an additional 24 h. Luciferase activity was measured using a Dual‐Luciferase Reporter Assay System (Promega). All data were normalized to Renilla luciferase controls. Data are expressed as the fold changes compared with the controls. Each assay was conducted in quadruplicate.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!