Transit lt1 transfection reagent
TransIT-LT1 is a cationic lipid-based transfection reagent designed for efficient delivery of DNA, RNA, and other macromolecules into a variety of mammalian cell types. It is formulated to facilitate the uptake of nucleic acids into the target cells.
Lab products found in correlation
13 protocols using transit lt1 transfection reagent
Generating IFN-β Responsive Reporter Cell Line
Construction of EGFP-tagged Golgi Enzyme Reporter
Dual-Luciferase Assay for Transcriptional Activity
Estrogen Receptor Luciferase Assay
Lenti-X 293T Cell Transduction and TRIM5 Expression
Retroviral Infection and Rescue in MEFs
Myod1 and Myog Promoter Assay
Stable AQP8 Knockdown and Overexpression in 3T3-L1 Cells
Lentiviral Knockdown of Catecholamine Genes
20 Briefly, 293FT cells (Thermo Fisher Scientific) were transfected with the pLKO.1‐puro‐shRNA expressing vector, psPAX2, and pMD2.G (Addgene) using TransIT‐LT1 Transfection Reagent (TaKaRa Bio) and Opti‐MEM (Thermo Fisher Scientific). The virus‐containing medium was harvested 60 h after transfection. The following are the target sequences of RNAi used in this study: Human TH#1, GACGTACCAGTCAGTCTACTT; Human TH#2, GTTCGGGCTGTGTAAGCAGAA; Human DDC#1, GCTGGCCTGATTCCTTTCTTT; Human DDC#2, CGACGTTGAGAAGATAATCAT; Human DBH#1, GCGGGTGCCGCTTAAACATTT; Human DBH#2, CTTCAACCGCGACGTACTGAA; Human PNMT#1, GAGGACATCACCATGACAGAT; Human PNMT#2, GCACCCTCATCGACATTGGTT; Human VMAT1#1, GCGTACCTAGTGGAATAGCAT; Human VMAT1#2, GCTGGCTTTGTTATCATGTTT; Human VMAT2#1, GCTCTTCTGGGAATGATAATT; Human VMAT2#2, GGATCACAACTGCCCTATTAA; and Control, CCTAAGGTTAAGTCGCCCTCG.
Wnt3a Pathway Activation Assay
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!