Hiscript 3 all in one rt supermix

Total CD4⁺T cells were isolated from the spleen of mice by mouse CD4 microbeads (Miltenyi Biotec, catalog 130-117-043). TRIzol reagent (MRC, catalog TR118) was used to extract total RNA from cells. HiScript III All-in-one RT SuperMix (Vazyme, catalog R333) was used to generate cDNA according to the manufacturer’s instructions. ChamQ Universal SYBR qPCR Master Mix (Vazyme, catalog Q711) was used for selected gene amplification. The relative expression of selected genes was analyzed by ΔΔCt method, which normalized to the house-keeping gene β-actin. The following primers are used: β-actin: FP, GTGACGTTGACATCCGTAAAGA; RP, GCCGGACTCATCGTACTCC. Il2r: FP, TGGCAACACAGATGGAGGAAG; RP, ACAGCCGTTAGGTGAATGCT. Foxp3: FP, CCCCCTCTAGCAGTCCACTT; RP, AAGTTGCCGGGAGAGCTGAA. Tfrc: FP, TTCGCAGGCCAGTGCTAGG; RP, TACAAGGGAGTACCCCGACAG. Fth: FP, CAGACCGTGATGACTGGGAG; RP, TCAATGAAGTCACATAAGTGGGGA.

Reverse transcription-quantitative PCR (RT-qPCR) using gene-specific primers (Table S1) based on the RNA-seq data was designed using Primer Premier Version 5.0 (PREMIER Biosoft International, Palo Alto, CA, USA) software [51 (link)]. RT-qPCR was used to validate the expression of eleven selected DEGs related to cytochrome P450, drug resistance, ABC, and MFS (Table S1). RT-qPCR was conducted following the procedure published by Dossa et al. [52 (link)], using total RNA extracted from strains TJ-NH-51S-4 and TJ-NH-51S-VF as templates. First strand cDNA was synthesized using HiScript III All-in-one RT SuperMix (Vazyme). RT-qPCR was conducted using a Thermo QuantStudio1 thermocycler with ChamQ Universal SYBR qPCR Master Mix (Vazyme) according to the manufacturer’s instructions. The histone 3 gene (HIS3) was used as an internal control. Each reaction was carried out using a 20 µL mixture consisting of 10 µL of 2 × ChamQ Universal SYBR qPCR Master Mix, 6 µL of nuclease-free water, 1 µL of each primer (10 mM), and 2 µL of 20 ng diluted cDNA. The RT-qPCR analysis utilized three biological replicates and was conducted three times. The cycling profile was 95 °C for 30 s, followed by 40 cycles of 95 °C/10 s and 60 °C/30 s. Data are presented as relative transcript levels that were derived using the 2^−ΔΔct technique [53 (link)].

Total RNA was extracted using the FastPure total RNA isolation kit (Vazyme Biotech Co., Nanjing, China) and reverse-transcribed to complementary DNA using HiScript III All-in-one RT SuperMix (Vazyme Biotech Co, Nanjing, China), according to the manufacturer’s instructions. Real-time PCR was performed with SYBER Green PCR Master Mix (Vazyme Biotech Co, Nanjing, China) using a StepOnePlus PCR system (Applied Biosystems, Foster City, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal normalizer. Primer sequences are noted in the Supplementary materials. Western blot was used to measure α-SMA expression levels in CFs. The primary antibodies were anti-α-SMA (Abcam, Cambridge, UK) and anti–β-tubulin (ABclonal, Wuhan, China).

IPEC-J2 cells at a density of 5 × 10⁵ were seeded in six-well plates and incubated for 24 h to make them adherent. The processing method of each group of IPEC-J2 cells as shown in 4.2, then total RNA was extracted using a fastpure cell total RNA isolation kit (RC112-01, Vazyme, Nanjing, China). cDNA was synthesized from 1 μg of total RNA using HiScript III All-in-one RT Supermix (R333-01, Vazyme, Nanjing, China). ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme, Nanjing, China) (10 μL) was added to 20 μL of a reaction mixture containing cDNA (1 μL) and 0.4 μL of gene-specific forward and reverse primers (10 μM), respectively. cDNA was amplified for 40 cycles using an applied Biosystems QuantStudio 3 Flex Real-time PCR system. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene for normalizing the gene levels. The expression levels of target genes were calculated using the 2^−ΔΔC_T method. All the primers used in this study are listed in Table 1.

Total cellular RNA was isolated from 1 × 10⁵ lentiviruses‐infected cells using a RNeasy Kit (Qiagen, Germany) as instructed by the manufacturer, reverse‐transcribed into complementary DNA (cDNA) using HiScript III All‐in‐one RT SuperMix (Vazyme, China), and subjected to quantitative real‐time RT‐PCR with GAPDH as an endogenous control. cDNA was quantified using ChamQ SYBR Color qPCR Master Mix (Vazyme). The sequences of the PCR primers were listed in Table S2. PCR was performed at 94°C for 4 min, followed by 40 cycles of 94°C for 1 min, 56°C for 1 min, and 72°C for 1 min. Expression of ZNF683 and SH2D1B was normalized to that of GAPDH using the 2^ΔΔCT method.

For osteogenic evaluation, hBMSCs were seeded on the G, G/M, G/B-M, F-G/B-M hydrogel at a 1 × 10⁵ cells/sample density. BMSCs in pure culture medium was regarded as the blank control group. Following 3, 7 and 14 days of culture, total RNA was extracted by RNAiso plus (Takara, Japan). Complementary DNA (cDNA) was synthesized from 1 μg RNA by HiScript III All-in-one RT SuperMix (Vazyme, China). RT-qPCR was performed by SYBR Green Real-Time PCR Master Mixes (Thermo, USA). Two-step cycling conditions were as follows: 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 60 °C for 30 s.
For angiogenic evaluation, HUVECs in the pure medium was regarded as the blank control group, and the cells were seeded on the G, G/M, F-G/M, F-G/B-M hydrogel at a 5 × 10⁴ cells/sample density. After three days, the expression of angiogenic genes was assessed with a procedure similar to that described above. β-actin was selected as an internal control, and the primer sequences used were described in Additional file 1: Table S1.