Anti rarα

Manufactured by Santa Cruz Biotechnology

Sourced in United States

Anti-RARα is a laboratory reagent used for the detection and quantification of the retinoic acid receptor alpha (RARα) protein in biological samples. It is a specific antibody that binds to the RARα protein, allowing for its identification and measurement through various analytical techniques.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Anti-RARα antibody (2 citations) Anti-RARα (C-20; (2 citations)

8 protocols using anti rarα

Transcription Factor Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNAP assay was performed as previously described [23] (link). The biotin-labeled DNA probes (Sigma-Aldrich) were annealed to complementary oligonucleotides. COS-7 cells were transfected with 1 µg of expression vectors using LipofectAmine 2000 (Invitrogen), according to the manufacturer's instructions. Transfected COS-7 cells or nuclear fractions of BM-DCs were lysed or diluted with DNAP binding buffer [25 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.25% NP-40, 1 mM DTT and Complete Protease Inhibitor Cocktail (Nacalai Tesque)], respectively. Cell debris was removed by centrifugation (20,000×g) for 10 min. Lysates were first incubated with Streptavidin-Sepharose beads (GE Healthcare) for 30 min to eliminate nonspecific binding and then incubated with 1.5 µg of poly(dI-dC) and 2 µg of biotinylated DNA probe for 1 h at 4°C. Streptavidin-Sepharose beads were then added and incubated with these mixtures for an additional 30 min at 4°C. After washing the beads three times in DNAP binding buffer, precipitated proteins were eluted in SDS-PAGE sample buffer. Samples were analyzed SDS-PAGE followed by Western blot analysis using anti-Sp1 (Santa Cruz Biotechnology), anti-Myc (Nacalai Tesque), anti-RARα (Santa Cruz Biotechnology), and anti-RXRα (Santa Cruz Biotechnology) Abs.

Ohoka Y., Yokota-Nakatsuma A., Maeda N., Takeuchi H, & Iwata M. (2014). Retinoic Acid and GM-CSF Coordinately Induce Retinal Dehydrogenase 2 (RALDH2) Expression through Cooperation between the RAR/RXR Complex and Sp1 in Dendritic Cells. PLoS ONE, 9(5), e96512.

+ Open protocol

+ Expand

Protein Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

After isolation, content determination and electrophoresis, proteins were elettroblotted [46 (link)] and incubated with a polyclonal rabbit anti-CRBP-1, anti-Creb1, anti-CD44, anti-c-Jun, anti-Nox4, anti-p53, anti-RXRα, anti-RARα (Santa Cruz Biotechnology), anti-RARβ, (Abcam), anti-phosphorylated v-akt murine Jesi AN, Italy) and then sequenced using PyroMark Q24 thymoma viral oncogene homolog (pAkt Ser⁴⁷³), anti-AKT (pan), anti-phosphorylated extracellular-signal-regulated kinases (pErk1/2), anti-phosphorylated epidermal growth factor receptor (anti-EGFR Thr669), anti-EGFR antibody (Cell Signaling Technology, Danvers, MA, USA), anti-keratin 5 (clone H-40, Santa Cruz Biotechnology), mouse anti-vimentin (clone J144, Abcam), anti-keratin 14 (LL001, Santa Cruz Biotechnology) and anti-total tubulin antibody (Sigma-Aldrich). Revelation and densitometric blot analysis were performed in three independent experiments and Akt and EGFR activity expressed as phospho/total protein ratio [47 (link)].

Doldo E., Costanza G., Ferlosio A., Pompeo E., Agostinelli S., Bellezza G., Mazzaglia D., Giunta A., Sidoni A, & Orlandi A. (2015). High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis. Genes & Cancer, 6(11-12), 490-502.

+ Open protocol

+ Expand

Immunoblot Analysis of RASSF1A, RARα, Cyclin D1, and p53

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunoblot analysis was performed as previously described (11 (link)). Following antibodies were used: mouse monoclonal and polyclonal antibody anti-RASSF1A for analyzing human cell lines and primary patient cell samples, rabbit polyclonal antibody anti-RASSF1 for analyzing mouse bone marrow samples (both Abcam, Cambridge, UK) and rabbit polyclonal antibody anti-RARα, rabbit polyclonal antibody anti-Cyclin D1 and rabbit polyclonal antibody anti-p53 (Santa Cruz Biotechnology, Dallas, Texas, USA). Rabbit polyclonal antibodies anti-βTubulin and anti-GAPDH were used for normalization (both Santa Cruz Biotechnology). Immunodetection was performed with WesternSure Chemiluminescent Substrate (LI-COR bioscience, Lincoln, NE, USA). Band intensities were quantified using Image J software (National Institutes of Health).

Bräuer-Hartmann D., Hartmann J.U., Wurm A.A., Gerloff D., Katzerke C., Falzacappa M.V., Pelicci P.G., Müller-Tidow C., Tenen D.G., Niederwieser D, & Behre G. (2015). PML/RARα-regulated miR-181a/b-cluster targets the tumor suppressor RASSF1A in Acute Promyelocytic Leukemia. Cancer research, 75(16), 3411-3424.

+ Open protocol

+ Expand

Whole-embryo ChIP for Retinoic Acid Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP was performed according to the manufacturer’s protocol (Active Motif) as described (Frank et al., 2001 (link)). To perform whole-embryo ChIP, nuclear extracts were prepared from pooled wild-type E8.25 mouse embryos as previously described (Kumar and Duester, 2014 (link)); antibodies included anti-RARα or anti-RARγ (Santa Cruz Biotechnology) or anti-RARβ (Affinity Bioreagents). ChIP samples were subjected to PCR using primers flanking the mouse Wnt8a RARE near −4.9 kb (5′-ATC TTG GGT TGA GGC AGA GTC TC-3′ and 5′-CGC TGA GCC ACC TCT ACA ATC TT-3′ that generate a 280bp PCR product) or primers flanking a non-specific region located at −9.7 kb (5′-TCA GAC ATG GCC TCC ACT AGA AC-3′ and 5′-CCC CGT TGA GGT ATT TCT TTT GGC-3′ that generate a 219bp PCR product).

Cunningham T.J., Kumar S., Yamaguchi T.P, & Duester G. (2015). Wnt8a and Wnt3a Cooperate in the Axial Stem Cell Niche to Promote Mammalian Body Axis Extension. Developmental dynamics : an official publication of the American Association of Anatomists, 244(6), 797-807.

+ Open protocol

+ Expand

Protein Expression Analysis by Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols

After isolation, content determination and electrophoresis, proteins were elettroblotted [29 (link)] and incubated with a polyclonal rabbit anti-CRBP-1, anti-RXRα, anti-RARα (1:500, Santa Cruz Biotechnology, USA), anti-RARβ, anti-RARγ, anti-cytokeratin-5/6, anti-cytokeratin-10 (1:500, Abcam, Cambridge, UK), anti-phosphorylated-AKT (pAKT Ser⁴⁷³), anti-AKT, anti-phosphorylated ERK1/2, anti-phosphorylated EGFR (Thr669) and mouse anti-total tubulin antibody (Sigma-Aldrich), followed from horseradish peroxidase conjugate goat anti-rabbit or anti-mouse IgGs (Pierce, Rockford, USA). Specific complexes were revealed and quantified as reported [29 (link)] in three independent experiments. AKT and EGFR activity expressed as phospho/total protein ratio [30 (link)].

Ferlosio A., Doldo E., Agostinelli S., Costanza G., Centofanti F., Sidoni A, & Orlandi A. (2020). Cellular retinol binding protein 1 transfection reduces proliferation and AKT-related gene expression in H460 non-small lung cancer cells. Molecular Biology Reports, 47(9), 6879-6886.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation of Transcription Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin immunoprecipitation (ChIP) assay was performed according to Upstate Biotechnology protocol (Lake Placid, NY, USA). Briefly, 5 × 10⁶ cells were crosslinked in vivo, lysed, and immediately sonicated. Chromatin fragments were immunoprecipitated with 4 μg of anti-HHEX (Epitomics) or anti-RARα (SantaCruz) antibody; and after treatment with proteinase K for 2 h at 68 °C, the DNA was purified by phenol/chloroform extraction and amplified by Hot-start PCR (30 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) using the following primers:
VEGFR-2 (FWD) 5′CCTTCTTGGGGCTAGGCAGGTCACTTCA3′ (−671 to −644), and VEGFR-2 (REV), 5′GATCTCCAGCTCCCCAAGCCCATTTA3′ (−148 to −123).
VEGF (FWD) 5′AAAGACCCAACTCAAGTATCATCTSSAGT3′, and VEGF (REV) 5′CACTCACTGTGTGTGGCCTTAGGTTATTCAAC3′.
HHEX (FWD) 5′GGTTCAACAGGTTTGTGCAGT3′ and HHEX (REV) 5′CCGGCTATCAGAAGTCGAGTG3′.

Saulle E., Petronelli A., Pelosi E., Coppotelli E., Pasquini L., Ilari R., Lo-Coco F, & Testa U. (2016). PML-RAR alpha induces the downmodulation of HHEX: a key event responsible for the induction of an angiogenetic response. Journal of Hematology & Oncology, 9, 33.

+ Open protocol

+ Expand

Quantification of Cell Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stably transfected MCF-7 and MDA-MB-231 cells or peptide-treated wild type MCF-7 and MDA-MB-231 cells were collected and lysed using an RIPA buffer. The BCA (Pierce kit #23225) method was used for protein quantitation of the whole cell lysates. The whole cell lysates were subjected to SDS-PAGE and Western blotting. Specific proteins were probed using anti-Sin3A (cat#sc-5299, Santa Cruz Biotechnology, Dallas, TX, USA), anti-RARα (cat# sc-515796), anti-RXRα (cat#sc-515929, Santa Cruz Biotechnology, Dallas, TX, USA) and anti-RARβ (cat# sc-56864 Santa Cruz Biotechnology, Dallas, TX, USA), followed by incubation with HR0 conjugated anti-mouse antibodies (cat# 7076, Cell Signaling technologies, Denvers, MA, USA). The bands were visualized by chemiluminescence.

Dahiya N.R., Leibovitch B.A., Kadamb R., Bansal N, & Waxman S. (2022). The Sin3A/MAD1 Complex, through Its PAH2 Domain, Acts as a Second Repressor of Retinoic Acid Receptor Beta Expression in Breast Cancer Cells. Cells, 11(7), 1179.

+ Open protocol

+ Expand

Western Blot Analysis of Protein Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols

Denatured protein extracted from isolated cells was loaded on a 10% SDS-PAGE gel, electrophoresed, and then transferred onto a PVDF membrane. PVDF membranes were blocked with 5% fat-free milk, and the membranes were then probed with anti-N1CD (CST), anti-N2ICD (CST), anti-Actin-HRP (MBL), anti-Flag (Abmart), anti-RARα (Santa Cruz) and anti-mouse-p-MLKL (Abcam) at 4°C O/N. Blots were then incubated with secondary antibody. Peroxidase activity on the membrane was visualized on X-ray film using the ECL western blotting detection system.

Lu Z., Xie Y., Huang H., Jiang K., Zhou B., Wang F, & Chen T. (2020). Hair follicle stem cells regulate retinoid metabolism to maintain the self-renewal niche for melanocyte stem cells. eLife, 9, e52712.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!