The SFO from Etv1-CreER/Ai9 or Slc32a1-Cre/Ai9 mice were dissected under a fluorescence microscope, ensuring minimal addition of adjoining tissue. The SFO was dissociated into single cells using Papain Dissociation System (Worthington), labeled with DAPI, and thw tdTomato+ neurons sorted using a flow cytometer (MoFlo Astrios, Beckman Coulter). RNA was extracted using the PicoPure RNA isolation kit (Applied Biosystems), and cDNA prepared using the Ovation RNA-seq V2 kit (Nugen). Quantitative real-time PCR was performed using the following sets of primers; ETV-1 (5′ primer: CAAACATCCCCTTCCCACCA; 3′ primer: ATAGAACTGCCTGGGACCCT), nNOS (5′ primer: CGGGAATCAGGAGTTGCAGT; 3′ primer: CAGAGCCGTGTTCCTTTCCT), Vgat (5′ primer: TCATCGAGCTGGTGATGACG; 3′ primer: CTTGGACACGGCCTTGAGAT), AT1 (5′ primer: CAACTGCCTGAACCCTCTGT; 3′ primer: TCCACCTCAGAACAAGACGC), GAPDH (5′ primer: GGTTGTCTCCTGCGACTTCA; 3′ primer: TAGGGCCTCTCTTGCTCAGT). Data were normalized to GAPDH.
Ovation rna seq v2 kit
Manufactured by Tecan
Sourced in United States
The Ovation RNA-seq V2 kit is a laboratory equipment product designed for RNA sequencing. It provides a streamlined workflow for the preparation of RNA samples for next-generation sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Picopure rna isolation kit, by Thermo Fisher Scientific (3 mentions)
Moflo astrio, by Beckman Coulter (3 mentions)
Papain dissociation system, by Worthington (3 mentions)
Minelute reaction cleanup kit, by Qiagen (3 mentions)
Nextseq 500 platform, by Illumina (2 mentions)
Ingenuity pathway analysis (ipa), by Qiagen (2 mentions)
Ion s5 xl system, by Thermo Fisher Scientific (2 mentions)
S1 nuclease, by Promega (2 mentions)
Sizeselect e gels, by Thermo Fisher Scientific (2 mentions)
Truseq dna sample preparation kit v2, by Illumina (2 mentions)
Hiseq 2000 platform, by Illumina (1 mentions)
Rneasy minelute column, by Qiagen (1 mentions)
Bioanalyzer rna pico chip, by Agilent Technologies (1 mentions)
Genejet pcr purification kit, by Thermo Fisher Scientific (1 mentions)
Ecorv, by Thermo Fisher Scientific (1 mentions)
Genjet pcr purification kit, by Thermo Fisher Scientific (1 mentions)
2100 bioanalyzer, by Agilent Technologies (1 mentions)
Hiseq 4000, by Illumina (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Gaiix, by Illumina (1 mentions)
17 protocols using ovation rna seq v2 kit
1
Molecular Profiling of SFO Neurons
2
RNA-Seq Protocol for Whole Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA (5 ng) was subjected to whole transcriptome amplification using NuGEN's Ovation RNA-Seq V2 kit (San Carlos, CA, USA) according to manufacturer's instructions. Briefly, cDNA was amplified from total RNA using a single primer isothermal amplification (SPIA). The amplified cDNA samples were subsequently purified using a MinElute Reaction Cleanup Kit (Qiagen; Valencia, CA, USA). The cDNA samples were fragmented into smaller pieces, blunt-ended, and ligated to indexed (barcoded) adaptors and amplified using an Ultralow System V2 kit according to the manufacturer's protocol. Final library size distribution was determined using an Agilent Bioanalyzer 2100. Five libraries from five different donors were sequenced on the Illumina NextSeq500 platform (San Diego, CA, USA). The FASTQ files were uploaded to UPPMAX and quality checked using fastQC (39 ). Trimmomatic (40 (link)) was used to remove adaptors and low-quality bases and the reads were then mapped to human reference genome hg19 using STAR (41 (link)). Counts for each gene were calculated using featureCounts (42 (link)). The data was normalized and differentially expressed genes determined using R/DeSeq2 (43 (link)). Analysis of pathways was done by Ingenuity Pathway Analysis (Qiagen), R analysis, Gene Ontology (GO) Enrichment Analysis (Geneontology.org), and custom gene lists.
3
RNA Extraction and Sequencing for C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from FACS-sorted samples as previously described [2 (link)]. Briefly, RNA was extracted using standard Trizol/ chloroform/ isopropanol method, DNase digested, and cleaned using Qiagen RNEasy Minelute columns. Agilent Bioanalyzer RNA Pico chips were used to assess quality and quantity of isolated RNA. 10 to 100 ng of the isolated quality assessed RNA was then amplified using the Nugen Ovation RNAseq v2 kit, as per manufacturer suggested practices. The resultant cDNA was then sheared to an average size of ~200 bp using Covaris E220. Libraries were prepared using either Nugen Encore NGS Library System or the Illumina TruSeq DNA Sample Prep, 1 μg of amplified cDNA was used as input. RNA from a subset of samples was amplified using the SMARTer Stranded Total RNA kit-pico input mammalian, as per manufacturer suggested practices. No differences were observed between the two methods, and samples amplified by different methods clustered well (Fig 1B ). The resultant sequencing libraries were then submitted for sequencing on the Illumina HiSeq 2000 platform. 35–200 million reads (average of 107,674,388 reads) were obtained for each sample and mapped to the C. elegans genome. Sequences are deposited at NCBI BioProject PRJNA400796.
4
RNA-Seq Library Preparation from Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extractions were divided into two tubes for each rat, for a total of 12 tubes. Six tubes were normalized to 100 ng/μl in a 5 μl volume, for a total of 500 ng of RNA, and subjected to whole transcriptome amplification using NuGEN’s Ovation RNA-Seq V2 kit (San Carlos, CA, USA) according to manufacturer’s instructions. This kit provides a rapid method for preparing amplified cDNA from total RNA for downstream RNA-Seq applications. It employs a single primer isothermal amplification (SPIA) method to amplify total RNA into double stranded cDNA and depletes rRNA without preselecting mRNA. Amplified cDNA samples were then purified using the MinElute Reaction Cleanup Kit (Qiagen; Valencia, CA, USA) according to manufacturer’s protocol. After the amplification procedure, cDNA concentrations ranged from 421–575 ng/ul (Additional file 1 : Table S2). Paired amplified cDNA (n = 6) and unamplified raw RNA samples (n = 6) were then sent to Duke GCB Genome Sequencing Shared Resource for library preparation and sequencing.
5
Random PCR and SPIA Amplification for RNA-Seq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA was amplified using random PCR as described elsewhere [14 (link)]. The PCR tag-sequence was cleaved away using EcoRV (Thermo Fisher, Waltham, MA, USA). The RNA was reverse-transcribed into cDNA and amplified by single-primer isothermal amplification (SPIA) using the Ovation RNA-Seq V2 kit (NuGEN, San Carlos, CA, USA) according to the manufacturer’s instructions. The random PCR products and the SPIA products were then purified using the GeneJET PCR purification kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions. The concentrations of the purified random PCR products ranged from 18 to 25 ng/µL, and those of the purified SPIA products ranged from 36 to 66 ng/µL. All the products were sequenced at SciLifeLab/Genome Center (Uppsala, Sweden) using the Ion S5 XL system (Thermo Fisher, Waltham, MA, USA) and two 530 chips. The main type of sequencing errors associated with this platform are insertions and deletions (indels).
6
Single-primer isothermal RNA-seq amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The remaining RNA was used to obtain cDNA and amplified through a Single-primer isothermal amplification (SPIA) approach using the Ovation RNA-seq v2 kit (NuGEN, San Carlos, CA, USA) according to the manufacturer’s instructions. The SPIA products were purified using Genjet PCR purification kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions before being sequenced at SciLifeLab/Genome Center (Uppsala, Sweden) using the Ion S5 XL system (Thermo Fisher, Waltham, MA, USA) and a 530 chip.
7
Whole Transcriptome Profiling of DC-NK Crosstalk
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole transcriptome amplification of RNA purified from DCs and NK cells from single and NK–DC cross talk cultures was done using NuGEN’s Ovation RNA-Seq V2 kit following the protocol provided by the company (San Carlos, CA, USA). cDNA was amplified from total RNA using a single primer isothermal amplification and purified using a MinElute Reaction Cleanup Kit (Qiagen; Valencia, CA, USA). The cDNA samples were fragmented, barcoded with adaptors, and amplified using an Ultralow System V2 kit. Distribution of the size of the library was determined using an Agilent Bioanalyzer 2100. Libraries from three different donors were sequenced on the Illumina NextSeq500 platform (San Diego, CA, USA). The fastq files were uploaded and the quality checked using fastQC (31 ). Trimmomatic (32 (link)) was used to remove adaptors and low-quality bases and the reads were then mapped to human reference genome hg19 using STAR. FeatureCounts was used to calculate counts for each gene (33 (link)). The data were normalized and R/DeSeq2 used to determine differentially expressed genes (34 (link)). Analysis of pathways was done by Ingenuity Pathway Analysis (Qiagen), R analysis, and custom gene lists.
8
RNA-seq Library Preparation from Fragmented Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was amplified and converted to cDNA using the Ovation RNA-Seq V2 Kit (Nugen) according to the manufacturer’s instructions. The Ovation RNA-Seq kit utilizes custom oligo dT and random primers that do not bind to ribosomal sequences during reverse transcription and work well on fragmented samples 46 (link). Excess ssDNA products were removed using Promega S1 nuclease 47 (link). Libraries were prepared using the TruSeq DNA Sample Preparation v2 Kit (Illumina). PCR cycles were titrated to ensure minimal amplification bias. Size selection was performed using SizeSelect E-Gels (Invitrogen). Finished libraries were sequenced on the HiSeq2000 at the Tufts University Core Facility. Libraries at ~300 bp (~180 bp insert size) were used for 50bp single end sequencing and libraries at ~400 bp (~280 bp insert size) were used for 100bp paired end sequencing.
9
Transcriptome Analysis of Date Palm Flowers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Date palm flowers and leaves were collected from two separate male and two separate female trees at anthesis during the flowering season of 2016 in Doha, Qatar. Total RNA was extracted according to the protocol described by Chang et al.44 (link) followed by on-column DNase treatment using the RNeasy plant mini kit (Qiagen). mRNA-seq libraries were constructed using the Ovation RNA-seq V2 kit (NuGen, San Carlos, CA) according to the manufacturer’s protocol. Libraries were sequenced using either 75 or 150 bp read-lengths on a HiSeq4000 (Illumina, CA) according to the manufacturer’s recommended protocol. Sequences were quality trimmed, replicates combined, and aligned to repeat-masked scaffolds using HISAT2 (ref. 45 (link)). Sequence counts were normalized to fragments mapping per kb of non-sex-linked control scaffold sequence.
10
Mitochondrial Gene Expression in Bovine Oocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the level of expression of mitochondrial genes, 12 mitochondrial transcripts abundance were obtained from GEO Series GSE52415 acquired from sequencing pools of 10 denuded bovine oocytes and 10 blastocysts produced in vitro28 (link). Briefly, the libraries were prepared with Ovation RNAseq v2 kit (NuGEN) and the barcoded libraries were pooled for multiplexed sequencing on an Illumina GAIIx to a mean coverage of 20 × 106 reads each. Sequencing runs were done in single-read mode with an 80-base read length.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!