Codon optimized FLAG HPV-31 E2 (DeSmet et al., 2016 (link)) and the ori-luciferase plasmids for the PV transient replication assay (Fradet-Turcotte et al., 2010 (link)) were used as previously reported (DeSmet et al., 2016 (link)). FGFR-1, 2, and 4 constructs were provided by L. Thompson (UC Irvine). A Myc tag was added to the C terminus of FGFRs by PCR amplification using the following Primers Bam-FGFR1-F: GATCGGATCCATGTGGAGCT, FGFR1-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGCGGCGTTT, Bam-FGFR2-F: GATCGGATCCATGGTCAGCT, FGFR2-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCTGTTTTAACACTG, Bam-FGFR3-F: GATCGGATCCATGGGCGCCCCT, FGFR3-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCCGTCCGCGA, Kpn-FGFR4-F: GATCGGTACCATGCGGCTGC, FGFR4-myc-Not-R: GTACGCGGCCGCTCACAGATCCTCTTCTGAGATGAGTTTTTGTTCTGTCTGCAC, and inserted into pcDNA3. The following antibodies were used: mouse anti-FLAG M2, phospho-Tyrosine specific PY-99 (Santa Cruz) and PY-100 (Cell Signaling), rabbit anti-MYC (Cell Signaling), anti-FGFR1 (Abcam), anti-FGFR2 (Santa Cruz), and anti-FGFR4 (Santa Cruz). BPV-1 E2 was identified with B201, a mouse monoclonal antibody with an epitope between amino acids (aa) 160–220 (Breiding et al., 1996 (link)). Mouse-anti HPV-16-E2 (TVG-261) and HPV-16 E2 sheep-antiserum (Siddiqa et al., 2015 (link)) were used to identify HPV E2 proteins.
Anti fgfr1
Manufactured by Abcam
Sourced in United States, United Kingdom, Germany
Anti-FGFR1 is a primary antibody that targets the Fibroblast Growth Factor Receptor 1 (FGFR1) protein. FGFR1 is a receptor tyrosine kinase that plays a crucial role in various cellular processes, including cell growth, differentiation, and survival.
Automatically generated - may contain errors
Lab products found in correlation
Anti p erk, by Cell Signaling Technology (2 mentions)
Anti β actin, by Merck Group (2 mentions)
Anti stat3, by Cell Signaling Technology (2 mentions)
Anti erk1 2, by Cell Signaling Technology (2 mentions)
Ripa lysis buffer, by Thermo Fisher Scientific (2 mentions)
Anti fgfr4, by Santa Cruz Biotechnology (1 mentions)
Mouse anti flag m2, by Santa Cruz Biotechnology (1 mentions)
Py100, by Cell Signaling Technology (1 mentions)
Rabbit anti myc, by Cell Signaling Technology (1 mentions)
Anti fgfr2, by Santa Cruz Biotechnology (1 mentions)
Protease and phosphatase inhibitors cocktail, by Thermo Fisher Scientific (1 mentions)
Ab17942, by Abcam (1 mentions)
Bovine serum albumin (bsa), by Euroclone (1 mentions)
Ab32538, by Abcam (1 mentions)
Supersignaltm west pico plus chemiluminescent substrate, by Thermo Fisher Scientific (1 mentions)
Ab32505, by Abcam (1 mentions)
Ta150041, by OriGene (1 mentions)
Non fat dried milk, by Euroclone (1 mentions)
Anti pstat3 d3a7, by Cell Signaling Technology (1 mentions)
Anti stat3, by Merck Group (1 mentions)
9 protocols using anti fgfr1
1
Codon-Optimized HPV-31 E2 and PV Replication Assay
2
Western blot analysis of signaling proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell pellets were resuspended and lysed in RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol), complemented with protease and phosphatase inhibitors cocktail (ThermoScientific). Total proteins extracts concentrations were determined through Bradford assay (Bio-Rad). Cytosol and nucleus protein fractions were obtained as previously described [47 (link)].
After 1 h blocking with 5% non-fat dried milk (EuroClone) or bovine serum albumin (SERVA) in Tris-buffered saline with 0.1% Tween (TBS-T), membranes were incubated with primary antibodies at 4 °C overnight. Primary antibodies used: anti-pFGFR1 (06-1433, Millipore), anti-FGFR1 (Abcam ab137765), anti-pSTAT3 (D3A7, Cell Signaling), anti-STAT3 (06596, Millipore), anti-pAKT1 (ab81283; Abcam), anti-AKT1 (ab32505; Abcam), anti-pERK1/2 (ab32538; Abcam), anti-ERK1/2 (ab17942; Abcam), anti t-GFP (TA150041, Origene) and β-actin (Sigma, A5441). After membrane incubation with horseradish-peroxidase-conjugated anti-rabbit secondary antibody (Immuno Reagents), the positive bands were visualized using the ECL kit SuperSignalTM West Pico PLUS Chemiluminescent Substrate (Thermo Scientific) as previously shown [48 (link)].
After 1 h blocking with 5% non-fat dried milk (EuroClone) or bovine serum albumin (SERVA) in Tris-buffered saline with 0.1% Tween (TBS-T), membranes were incubated with primary antibodies at 4 °C overnight. Primary antibodies used: anti-pFGFR1 (06-1433, Millipore), anti-FGFR1 (Abcam ab137765), anti-pSTAT3 (D3A7, Cell Signaling), anti-STAT3 (06596, Millipore), anti-pAKT1 (ab81283; Abcam), anti-AKT1 (ab32505; Abcam), anti-pERK1/2 (ab32538; Abcam), anti-ERK1/2 (ab17942; Abcam), anti t-GFP (TA150041, Origene) and β-actin (Sigma, A5441). After membrane incubation with horseradish-peroxidase-conjugated anti-rabbit secondary antibody (Immuno Reagents), the positive bands were visualized using the ECL kit SuperSignalTM West Pico PLUS Chemiluminescent Substrate (Thermo Scientific) as previously shown [48 (link)].
3
Immunohistochemical Assessment of Lung Adenocarcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Formalin-fixed and paraffin-embedded lung adenocarcinoma samples were incubated with primary anti-shisa3 (1:1000 dilution; Thermo Fisher Scientific, Rockford, IL, USA), anti-FGFR1 (1:200 dilution; Abcam, Cambridge, MA) or Ki-67 (1:200 dilution; ZSGB-BIO, Beijing, China)overnight at 4 °C followed by IgG/HRP polymer (ZSGB-BIO) and diaminobenzidine substrate (ZSGB-BIO) in compliance with protocols. Staining results were independently evaluated by two experienced pathologists who were blinded to all clinical data.
4
Immunohistochemical Profiling of Angiogenic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For this study we used the following antibodies: anti-FGFR1, anti-FGFR2, anti-VEGFR2, anti-PDGFRα, and anti-SMA (Abcam, Cambridge, UK); antimacrophage F4/80 and anti-CD205 (AbD Serotec MorphoSys, Duesseldorf, Germany); anti-CD4 (BD Bioscience, Heidelberg, Germany); anti-PDGFRβ (eBioscience, San Diego, CA) and anti-VEGFR1 (Novusbio, Littleton, CO). Furthermore the secondary antibody mouse antirat IgG-Cy3 (Dianova, Hamburg, Germany) was used for detection of anti-FGFR1, anti-FGFR2, anti-VEGFR1, anti-VEGFR2, anti- PDGFRα, anti-PDGFRβ, anti-macrophage F4/80, anti-CD205, and anti-CD4. anti-SMA was visualized with the secondary antibody goat anti-rabbit IgG-Alexa Fluor 555 (Invitrogen; Eugene, OR) and endothelial cells were detected with CD31-FITC (BD Biosciences, Heidelberg, Germany). All slides were covered with Vectashield Hard Set Mounting medium with DAPI (Vector Laboratories, Burlingame, CA) for nucleus staining.
5
Quantifying FGFR1 and β-klotho Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In brief, tissues were homogenized in tissue lysis buffer (Cell Signaling, MA, USA) supplemented with 1 mM phenylmethylsulfonyl fluoride. Protein concentrations were determined with the Bradford protein assay (Amresco, OH, USA). Then, 20 µg of protein was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis on a 10% Tris/HCl gel and transferred onto nitrocellulose membranes (Whatman, USA). Blotting with anti-FGFR1 (Abcam, UK), anti-β-klotho (R&D, MN, USA), anti-p-ERK (Cell Signaling), anti-p-P38 (Santa Cruz, Germany), and anti-β-actin (Sigma-Aldrich, MO, USA) antibodies was performed and the blots were developed with ECL prime (Amersham, USA). Results are expressed as fold change compared with data from visceral fat.
6
Immunohistochemical Staining of Paraffin Sections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IHC and cell blocks were prepared as described earlier53 ,54 . Staining was performed on 2 µm-thick paraffin sections, which were incubated with Target Retrieval Solution (EnVision Flex, Dako, Carpinteria, California, USA) at pH 9 and then with primary antibodies (anti-FGFR1 (Abcam, Berlin, Germany), dilution 1:5000, anti-pAKT (Abcam), 1:100, or anti-CD44 (Sigma–Aldrich, Taufkirchen, Germany), 1:1000, at room temperature for 20 min. Secondary antibody was visualized by using DAB substrate, and contrasting was achieved by hematoxylin staining.
7
FGFR1 Localization in Transfected Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forty-eight hours after transfection, cells were grown on glass coverslips, and cell culture dishes were fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton X-100, and blocked for 1 h in 5% FBS. Immunostaining was accomplished with anti-FGFR1 (1 : 200; Abcam, Shanghai, China) overnight at 4°C. Species-specific Alexa Fluor 555 secondary antibodies (Invitrogen, Waltham, MA) were used at 1 : 500 at room temperature for 1 h. Nuclei were visualized by DAPI (4′6-diamidino-2-phenylindole, blue). Protein localization was observed by fluorescence microscopy (Carl Zeiss, Germany).
8
Protein Lysate Preparation and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein lysates were obtained by cell lysis with radioimmunoprecipitation assay (RIPA) lysis buffer (Thermo Scientific), supplemented with 10% cOmplete protease inhibitor cocktail and 10% PhosStop phosphatase inhibitor cocktail (Roche Applied Science). Protein amount was quantified by BSA assay (Bio‐Rad Corporation). A total of 30 µg of protein per lane was resolved by 10% SDS–polyacrylamide gel electrophoresis (PAGE) (Bio‐Rad Corporation), followed by transferring to polyvinylidene fluoride (PVDF) membranes (Amersham) using Trans‐Blot Turbo System (Bio‐Rad Corporation). Chemiluminescent signals were detected by ECL Western Blotting Detection Reagents (GE Healthcare). Anti‐vWF (#sc‐53466, SantaCruz Biotechnology), anti‐β‐actin (#A5316, Sigma–Aldrich), anti‐VEGF‐A (#ab46154, Abcam), anti‐FGF2 (#ab208687), anti‐FGFR1 (#ab76464, Abcam), anti‐FGFR4 (#ab178396, Abcam), anti‐phospho‐FGFR4 (#ab192589, Abcam), anti‐phospho‐ERK1/2 (#9101, Cell Signaling Technology), anti‐ERK1/2 (#4695, Cell Signaling Technology), anti‐Sp1 ((#ab13370, Abcam), and anti‐STAT3 ((#12 640, Cell Signaling Technology) antibodies were used for immunoblotting.
9
FGF8-Induced FGFR1 Signaling Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After transfection for 24 h, cells were placed in medium without serum for another 24 h, and then incubated for 15 min with 1 nM FGF8 (PeproTech Inc., USA). Subsequently, the cells were subjected to immunoblotting with anti-p-FGFR1 (1 : 5000, Abcam), anti-FGFR1 (1 : 3500, Abcam), anti-p-ERK (1 : 1000, Cell Signaling Technology), anti-ERK1/2 (1 : 1000, Cell Signaling Technology), anti-p-Akt (1 : 1000, Cell Signaling Technology), anti-Akt (1 : 1000, Cell Signaling Technology), anti-p-STAT3 (1 : 1000, Cell Signaling Technology), anti-STAT3 (1 : 1000, Cell Signaling Technology), and anti-GAPDH (1 : 7000, Proteintech) to observe the expression of the FGFR1 phosphorylation levels as well as the relative phosphorylation levels of the downstream signaling molecules.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!