Zobell marine broth

The media components like Zobell Marine Broth, glucose, maltose, sucrose, lactose were obtained from Hi-Media, Mumbai India. Ethanol and silver nitrate were obtained from Merck India.

Biosurfactant producers were screened based on the surfactant activity exhibited by the culture media after 24–72 hours of incubation at 37°C in the presence of the bacterial isolates. In brief, Zobell marine broth (Hi Media) (100 mL in 1000 mL capacity conical flask) was sterilized and inoculated with the isolated cultures and was incubated at 37°C for 24–72 hours under shaking condition. Followed by incubation, the samples were made cell-free by centrifugation at 10,000 × g at 4°C. Biosurfactants activity of the cell free medium was assessed according to the procedure summarized in the following paragraphs and the isolates exhibiting appreciable surfactant activity were selected and subjected to identification and further production.

The bacterium was grown in Zobell marine broth (HiMedia, India) using sterilized sea water and incubated at 28 °C. The biochemical characterizations were done by using KB002, KB009A, KB009B and KB009C (HiMedia, India) based on standard procedures. The bacterial culture (50 µl) grown at log phase was transferred onto each well in the test kits and incubated at 37 °C for 24 h. The results were checked after appropriate incubation by comparing to biochemical test result chart accordingly to manufacturer instruction. Molecular characterization included extraction of genomic DNA followed by amplification using 16S rRNA primer (27F AGAGTTTGATCCTGGCTCAG and 1492R GGTTACCTTGTTACGACTT) and sequenced. The obtained sequences were aligned in MEGA6 and phylogenetic tree was constructed using neighbour-joining method. The genomic DNA G + C% was measured using thermal denaturation method.

The antibiotic resistance pattern of clinical isolates (13 S. aureus phenotypes) were collected from the clinical laboratories (Puducherry) and were screened against antibiotics (Himedia) such as ampicillin 10 mcg per disc, azithromycin 15 mcg per disc, chloramphenicol 30 mcg per disc, ciprofloxacin 5 mcg per disc, erythromycin 15 mcg per disc, gentamicin 10 mcg per disc, kanamycin 30 mcg per disc, mecillinam 10 mcg per disc, penicillin-G 10 units per disc and vancomycin 30 mcg per disc as per the Clinical & Laboratory Standards Institute: CLSI Guidelines (2013). The phenotypes (6) showed complete antibiotic resistance was selected for the activity screening.
The isolated colonies were cultivated on Zobell marine broth (Himedia) at 28 °C for 96 h at 200 rpm. The cell free supernatant (CFS) was obtained by centrifugation (Eppendorff) at 10 621 × g for 15 min and was used for the screening of antimicrobial activity by agar well diffusion assay.^{22 (link)} Muller Hinton agar (MHA) plates were prepared and overnight grown culture of S. aureus was swabbed on the surface of MHA plates. Then wells were made using a sterile steel cork borer and the wells were filled with 50 μl of cell free supernatant (CFS) and incubated at 37 °C for 24 h. Later the plates were inspected for zone formation.

Chloroauric acid (HAuCl₄·3H₂O), and other pure chemicals and biochemicals, were purchased from Sigma-Aldrich, India. Zobell Marine broth was purchased from Himedia, India. Freshly prepared aqueous solution of HAuCl₄ (1 mM), prepared using double-distilled (DD) water, was used in the experimental work. All the glassware used was sterilized and thoroughly washed with pure water. All other chemicals and reagents were of analytical grade.