Log In Sign up
The largest database of trusted experimental protocols

Snorna234

Manufactured by Thermo Fisher Scientific
Visit Supplier

SnoRNA234 is a laboratory equipment product designed for the detection and analysis of small nucleolar RNAs (snoRNAs) in biological samples. The core function of SnoRNA234 is to provide a precise and efficient method for the identification and quantification of snoRNA targets.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (3 mentions) U6 snrna, by Thermo Fisher Scientific (2 mentions) Rnase free dnase 1, by Thermo Fisher Scientific (1 mentions) Sybr green kit, by Thermo Fisher Scientific (1 mentions) Taqman probe, by Thermo Fisher Scientific (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Iscript kit, by Bio-Rad (1 mentions) Human hprt, by Thermo Fisher Scientific (1 mentions) Human primary mir 181b2, by Thermo Fisher Scientific (1 mentions) Mouse hprt, by Thermo Fisher Scientific (1 mentions) Mouse primary mir 181b2, by Thermo Fisher Scientific (1 mentions) Mir 181b 5p, by Thermo Fisher Scientific (1 mentions) Human primary mir 181b1, by Thermo Fisher Scientific (1 mentions) Taqman universal master mix 2, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Gotaq qpcr master mix, by Promega (1 mentions) 7500 real time rt pcr system, by Thermo Fisher Scientific (1 mentions) Snorna202, by Thermo Fisher Scientific (1 mentions) Mmu mir 155, by Thermo Fisher Scientific (1 mentions) Hsa mir 16, by Thermo Fisher Scientific (1 mentions)

5 protocols using snorna234

1

Quantifying Gene and miRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from mouse knee joints using Trizol (Life Technologies Corp, Carlsbad, CA) and treated with RNAse-free DNAse1 (Life Technologies Corp, Carlsbad, CA). cDNA was made using iScript kit (Bio-Rad Laboratories, Hercules, CA). Levels of gene expression were measured by quantitative PCR using SYBR Green kit (Life Technologies Corp, Carlsbad, CA). All measurements were normalized to endogenous Hprt1 mRNA. miR-223 level was measured by quantitative PCR using Taqman probe (002295) and normalized to the endogenous snoRNA234 (001234 Life Technologies Corp, Carlsbad, CA). Relative changes in RNA levels were assessed using the comparative CT method.
Coustry F., Posey K.L., Maerz T., Baker K., Abraham A.M., Ambrose C.G., Nobakhti S., Shefelbine S.J., Bi X., Newton M., Gawronski K., Remer L., Veerisetty A.C., Hossain M.G., Chiu F, & Hecht J.T. (2018). Mutant cartilage oligomeric matrix protein (COMP) compromises bone integrity, joint function and the balance between adipogenesis and osteogenesis. Matrix biology : journal of the International Society for Matrix Biology, 67, 75-89.
+ Open protocol
+ Expand
2

RNA Isolation and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from intima, PBMCs, and BMCs were isolated using TRIzol Reagent according to the manufacturer’s instructions. Subsequent RT-qPCR was performed using a High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems). For SyberGreen-based assay, GoTaq qPCR Master Mix (A6001, Promega) was used, and for TaqMan Universal Master Mix II, UNG (4440038, Life Technologies) was used. Expression of mRNAs and miRNA expression were normalized to β-actin or U6 (Aglient, AriaMx Real Time PCR System). Specific primers including miR-181b-5p (#001098), U6 (#001973), snoRNA234 (ID# 001234), human-Hprt (Hs05647472_cn), human-primary-miR-181b1 (Hs03302966_pri), human-primary-miR-181b2 (Hs03302963_pri), mouse-Hprt (Mm00522878_cn), mouse-primary-miR-181b1 (Mm03 307120_pri) and mouse-primary-miR-181b2 (Mm03307414_pri) were purchased from Life Technologies. VE-Cadherin forward primer CACTGCTTTGGGAGCCTTC and reverse primer GGGGCAGCGATTCATTTTTCT were used to detect VE-Cadherin mRNA expression. GAPDH primers are forward AGGTCGGTGTGAACGGATTTG and reverse TGTAGACCATGTAGTTGAGGTCA. Changes in expression were calculated using deltadelta Ct method. Primer sequences are described in (Supplemental Table SII).
Yang D., Haemmig S., Chen J., McCoy M., Cheng H.S., Zhou H., Pérez-Cremades D., Cheng X., Sun X., Haneo-Mejia J., Vellarikkal S.K., Gupta R.M., Barrera V, & Feinberg M.W. (2022). Endothelial cell-specific deletion of a microRNA accelerates atherosclerosis. Atherosclerosis, 350, 9-18.
+ Open protocol
+ Expand
3

Profiling Colon Mucosa MicroRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from frozen scraped colon mucosa according to the manufacturer's instructions for use of the TRIzol reagent (Invitrogen, Carlsbad, CA). RNA integrity was assessed using the Agilent 2100 Bioanalyzer RNA 600 nano assay (Agilent Technologies, Santa Clara, CA). MicroRNA microarray profiling was conducted as previously described [32] (link). Five mg of total RNA was labeled and hybridized to the microRNA microarray (Ohio State microRNA microarray version 4.0, Columbus, OH). Microarray data was deposited into Gene Expression Omnibus (accession number GSE56025).
Quantitative RT-PCR was used to validate specific microRNAs. The microRNAs that were validated included: hsa-miR-16; mmu-let-7f; mmu-miR-351; has-miR-150; has-miR-425; hsa-miR-196a; hsa-miR-138; and mmu-miR-155 (Applied Biosystems, Foster City, CA). Taqman MicroRNA assays (Applied Biosystems) were used according to the manufacturer's instructions in a 7500 real-time RT-PCR system (Applied Biosystems). Mouse specific small nuclear (sn)/small nucleolar (sno), snoRNA 202, snoRNA 234, and snoRNA 142 endogenous controls were used as the normalization controls (Applied Biosystems). All assays were performed in triplicate.
Olivo-Marston S.E., Hursting S.D., Perkins S.N., Schetter A., Khan M., Croce C., Harris C.C, & Lavigne J. (2014). Effects of Calorie Restriction and Diet-Induced Obesity on Murine Colon Carcinogenesis, Growth and Inflammatory Factors, and MicroRNA Expression. PLoS ONE, 9(4), e94765.
+ Open protocol
+ Expand
4

Comprehensive RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using TRIzol Reagent (Invitrogen) according to the manufacturer's instruction. Traces of genomic DNA were removed using the DNA-free DNA Removal Kit (Invitrogen). Equal amounts of RNA were reverse-transcribed with random hexamer primers using SuperScript III First-Strand Synthesis System (Invitrogen). For miRNA qRT-PCR, 10 ng of total RNA was reverse-transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). Quantitative RT-PCR for miRNA and mRNA levels were performed on a Quant Studio 5 Real-time PCR system (Applied Biosystems) using TaqMan Fast Universal PCR Master Mix, no AmpErase UNG (Applied Biosystems) and PowerUp SYBR Green Master Mix (Applied Biosystems), respectively. Gene expression was calculated using the Relative Standard Curve Method and 18S rRNA, as indicated, for normalization. All primer sequences are given in Table S1. The levels of miRNA were calculated using the ΔΔCt method and snoRNA234 or U6 snRNA for normalization. TaqMan assays for miR-501 (human: TM 002435, mouse: TM001651), miR-362 (TM: 002614), snoRNA234 (TM: 001234), and U6 snRNA (TM: 001973) were purchased from Applied Biosystems.
Fahrner A., Luca E, & Krützfeldt J. (2023). microRNA-501 controls myogenin+/CD74+ myogenic progenitor cells during muscle regeneration. Molecular Metabolism, 71, 101704.
+ Open protocol
+ Expand
5

Quantification of miR-21 in Liver

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from snap frozen human or mouse liver samples with Trizol reagent according to the manufacturer's instructions (Invitrogen, Paris, France). MiR-21 levels were quantified using TaqMan assay (Tm 00397, Applied Biosystems) following the manufacturer's instructions. miR-21 expression was normalised to U6 snRNA (Tm 001973, Applied Biosystems) for mouse and human samples, together with RNU6B (Tm 001093; Applied Biosystems) for human samples and snoRNA234 (Tm001234; Applied Biosystems) for mouse samples as endogenous control. Relative expression was calculated using the 2-delta-delta CT method followed by geometric average, as recommended.14 (link)
Loyer X., Paradis V., Hénique C., Vion A.C., Colnot N., Guerin C.L., Devue C., On S., Scetbun J., Romain M., Paul J.L., Rothenberg M.E., Marcellin P., Durand F., Bedossa P., Prip-Buus C., Baugé E., Staels B., Boulanger C.M., Tedgui A, & Rautou P.E. (2015). Liver microRNA-21 is overexpressed in non-alcoholic steatohepatitis and contributes to the disease in experimental models by inhibiting PPARα expression. Gut, 65(11), 1882-1894.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!