The RT-qPCR was carried out following the protocol of SYBR Green Dye kit (Vazyme, Nanjing, China). The reaction system (20 μL) included 1.3 μL of cDNA, 1 μL of forward primers, 1 μL of reverse primers, 6.7 μL of DEPC water, and 10 μL of SYBR Green Dye. RT-qPCR was conducted on an Applied Biosystems QuantStudio 3 system (Thermo Fisher, Waltham, MA, USA) following the conditions: pre-denaturation step at 95 °C for 5 min, 40 amplification cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s, and elongation at 72 °C for 15 s, followed by a final elongation step at 72 °C for 10 min. The reaction was performed using an Applied Biosystems QuantStudio 3 Real-Time PCR System (Themo Fisher). All the reactions were performed in triplicate. The relative expression of piRNA was calculated using the 2−ΔΔCt method [28 (link)]. Detailed information about the primers that were used in this work is shown in Table S1 .
Applied biosystems quantstudio 3 system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Applied Biosystems QuantStudio 3 system is a qPCR instrument designed for gene expression, genotyping, and other real-time PCR applications. It features a 96-well format, a touchscreen interface, and compatibility with a variety of sample types and chemistries.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green dye kit, by Vazyme (1 mentions)
Revertra ace qpcr rt kit, by Toyobo (1 mentions)
Thunderbird sybr qpcr mix, by Toyobo (1 mentions)
Isospin cell tissue rna kit, by Nippon Gene (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Thermo Fisher Scientific (1 mentions)
Trizol reagent kit, by Sangon (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Tb green pcr master mix, by Takara Bio (1 mentions)
7 protocols using applied biosystems quantstudio 3 system
1
RT-qPCR Analysis of piRNA Expression
2
Quantification of FTO mRNA in Bladder Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of bladder cancer cell lines and samples were extracted using TRIzol reagent according to the manufacturer’s instructions. cDNA was obtained using the PrimeScript™ RT reagent kit supplied by Takara (Dalian, China). Quantitative polymerase chain reaction (PCR) was performed in Applied Biosystems QuantStudio 3 system (Thermo Fisher Scientific, USA) using the corresponding PCR reagent from Takara (Dalian, China). Primer for FTO are 5′-AATAGCCGCTGCTTGTGAGA-3′ (forward) and 5′-CAATGGCACAGCATCCTCAT-3′ (reverse). Primer for β-actin are 5′-CCGTGAAAAGATGACCCAGATC-3′ (forward) and 5′-CACAGCCTGGATGGCTACGT-3′ (reverse). Real-time PCR was performed as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s to anneal. 2− ΔΔCq method was used to quantify the relative expression of FTO mRNA.
3
Cardiomyocyte Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription‐quantitative polymerase chain reaction was performed as described previously with slight modifications.
39 (link) Briefly, total RNA was extracted from cultured cardiomyocytes using an ISOSPIN Cell & Tissue RNA kit (314‐08211; NIPPON GENE CO., LTD., Tokyo, Japan). cDNA was generated via reverse transcription using a ReverTra Ace qPCR RT kit (FSQ‐201; TOYOBO, Osaka, Japan). Reverse transcription‐quantitative polymerase chain reaction was performed on an Applied Biosystems QuantStudio3 system (A28567; Thermo Fisher Scientific) with the THUNDERBIRD SYBR qPCR Mix (#QPS‐101; TOYOBO). The forward (F) and reverse (R) primer sequences were as follows: Rps18: F 5′‐AAGTTTCAGCACATCCTGCGAGTA‐3′, R 5′‐TTGGTGAGGTCAATGTCTGCTTTC‐3′; Ptgs2: F 5′‐TGAACACGGACTTGCTCACTTTG‐3′, R 5′‐AGGCCTTTGCCACTGCTTGTA‐3′.
39 (link) Briefly, total RNA was extracted from cultured cardiomyocytes using an ISOSPIN Cell & Tissue RNA kit (314‐08211; NIPPON GENE CO., LTD., Tokyo, Japan). cDNA was generated via reverse transcription using a ReverTra Ace qPCR RT kit (FSQ‐201; TOYOBO, Osaka, Japan). Reverse transcription‐quantitative polymerase chain reaction was performed on an Applied Biosystems QuantStudio3 system (A28567; Thermo Fisher Scientific) with the THUNDERBIRD SYBR qPCR Mix (#QPS‐101; TOYOBO). The forward (F) and reverse (R) primer sequences were as follows: Rps18: F 5′‐AAGTTTCAGCACATCCTGCGAGTA‐3′, R 5′‐TTGGTGAGGTCAATGTCTGCTTTC‐3′; Ptgs2: F 5′‐TGAACACGGACTTGCTCACTTTG‐3′, R 5′‐AGGCCTTTGCCACTGCTTGTA‐3′.
4
Total RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of total RNA was performed using the TRIzol Reagent Kit (Sangon Biotech, Shanghai, China) as previously described (74 (link)). Briefly, the crude RNA extraction was treated with DNase I (Thermo Fisher Scientific, Massachusetts, USA) at 37°C for 40 min to remove residual DNA. The purified RNA was reverse transcribed to cDNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Massachusetts, USA). RT-qPCR was performed in a total volume of 20 µL with PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, Massachusetts, USA) on an Applied Biosystems QuantStudio 3 System (Thermo Fisher Scientific, Massachusetts, USA). The primers used for RT-qPCR (Table S8) were designed using Primer Premier 6.0 (Premier, Canada) software.
5
RNA Extraction and qRT-PCR Analysis for Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Different tissues and organs of rice were excised from different plants and immediately put into liquid nitrogen for RNA extraction. Total RNA was prepared using the RNAiso Plus Reagent (Takara Bio Inc, Dalian, China) according to the manufacturer’s instructions. cDNA was obtained with PrimeScriptTM RT Master Mix (Takara Bio Inc, Dalian, China). For qRT-PCR, the cDNA was mixed with SYBR Premix Ex Taq II (TAKARA, Tokyo, Japan) and analyzed using an Applied Biosystems QuantStudio 3 system (Thermo Fisher Scientific, USA).
6
Quantifying LINC00460 Expression in Bladder Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 5637, T24, J82, TCCSUP, UM-UC-3 and SV-HUC-1 cells using TRIzol® reagent (Thermo Fisher Scientific, Inc.). Reverse transcription was conducted using the PrimeScript™ RT reagent kit with gDNA Eraser (Takara Biotechnology Co., Ltd., Dalian, China). qPCR was performed to detect the expression of LINC00460 using SYBR® Premix Ex Taq™ II kit (Takara Biotechnology Co., Ltd.). RT-qPCR assays were performed using an Applied Biosystems QuantStudio 3 system (Applied Biosystems; Thermo Fisher Scientific, Inc.), with β-actin as an endogenous control. The primer sequences used were as follows: LINC00460 forward, 5′-CGAGAAGGCCACCTATGAGC-3′ and reverse, 5′-TGAAGTGGATGGCTCAGGAA-3′; β-actin forward, 5′-CCGTGAAAAGATGACCCAGATC-3′ and reverse, 5′-CACAGCCTGGATGGCTACGT-3′. A two-step qPCR was performed as follows: Initial denaturation in 95°C for 30 sec; 40 of cycles of denaturation at 95°C for 5 sec; and annealing and elongation at 60°C for 34 sec. The 2−ΔΔCq method was used to quantify LINC00460 (24 (link)).
7
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol (Thermo Fisher) was used for RNA isolation. Extracted RNA (500 ng) was converted into cDNA using the PrimeScript™ RT reagent Kit (Takara). Quantitative RT-PCR (qRT-PCR) was performed using an Applied Biosystems QuantStudio 3 system (Applied Biosystems) and TB Green PCR Master Mix (Takara). Fold change was determined by comparing target gene expression with the reference gene 36b4. The sequences of primers used in this manuscript are in Supplementary Table S2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!