Bsegi

Isolation of genomic DNA from blood was performed using a commercially available kit (QIAamp DNA Blood Mini Kit, Qiagen, Hilden, Germany) following the manufacturer’s instructions. Genotypes of the C393T polymorphism were determined by PCR using the following primers: forward primer, 5`- TGT GGC CGC CAT GAG CAA -3`and reverse primer, 5`- TAA GGC CAC ACA AGT CGG GGT -3`. After an initial denaturation at 95°C, 38 cycles of DNA amplification were done using Ampliqon Mastermix (Odense M, Denmark) at 95°C for 30s, 64°C for 30s, 72°C for 30s and a final elongation step of 72°C for 10 min. The 145-bp PCR products were digested using the restriction enzyme BSE GI (Thermo Fisher Scientific, Waltham, MA USA) and analysed on a 2.8% agarose gel. The unrestricted products (145-bp) represent the TT genotype, the completely restricted products (77bp) represent the CC genotype.

A 163-bp fragment containing the SNP at nucleotide position HTR1A-1019 was amplified using the same setup of PCR-reaction and program as for SLC6A4. The reverse primer (Table 1) was designed to introduce a variable restriction site depending on if there is a C or a G in position HTR1A-1019, as previously described [22 (link)]. Subsequently, the introduced restriction site was detected by digesting 10 μl of the PCR product with the restriction enzyme BseGI in a total volume of 50 μl according to the manufacturer’s instructions (ThermoFisher, Waltham, Massachusetts, USA) and then separating the product on a 3.5% agarose gel. The undigested fragment (163 bp) carries the C and the digested one (146 bp/17 bp) carries the G in the same position.

The single-nucleotide polymorphism located in the exon 5 of the GNAS gene, GNAS c.393C>T (rs 7121), was for the first time detected by Mattera et al., and Kozasa et al. [5 (link),37 (link)]. Genomic DNA was extracted from 200 µL blood collected with EDTA with the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany). PCR was performed with 1.8 µL genomic DNA in the concentration of 10 ng/ μL and 30 µL Taq DNA-Polymerase 2× Master Mix Red (Ampliqon, Odense, Denmark) with the following conditions: initial denaturation at 95 °C for 3 min; 38 cycles with denaturation at 95 °C for 30 sec, annealing at 64 °C for 30 s, and elongation at 72 °C for 30 sec each; final elongation at 72 °C for 10 min (forward primer: 5′ TGTGGCCGCCATGAGCAA 3′; reverse primer 3′ TAAGGCCACACAAGTCGGGGT 5′). PCR products were digested with BseGI (Thermo Scientific, Dreireich, Germany), and restriction fragments were analyzed by agarose gel electrophoresis (Figure 1). For the various genotypes, the results of restriction fragment length polymorphism (RFLP)-PCR assays were validated by Sanger sequencing.
Hardy–Weinberg equilibrium (HWE) was calculated with Pearson’s chi square (χ²) goodness-of-fit test, and samples were considered to deviate from HWE at a significance level of p <0.05. Genotypes were compatible with HWE (χ² = 2.38; p = 0.12).