MegaScript T3 and T7 kits (ThermoScientific cat# AM1338/1334) were used to transcribe forward and reverse transcripts of differing lengths from major satellite repeat DNA, according to the manufacturer’s instructions. To obtain transcripts with one single consensus repeat, oligos containing the forward or the reverse major satellite consensus sequences were synthesised with the T7 (TAATACGACTCACTATAGGGACCTGGAATATGGCGAGAAAACT) or the T3 sequences (AATTAACCCTCACTAAAGGGTTCAGTGTGCATTTCTCATTTTTC), respectively (GeneScript) and hybridised. Two repeats were transcribed using the pCR4 Maj9–2 template, which was digested with SpeI or NotI for T7 or T3 Megascript kits, respectively84 (link) (a gift from Thomas Jenuwein). Eight repeats were transcribed from the pySat template87 (link) (a gift from from Niall Dillon, Addgene plasmid # 39238), which was digested with NotI or SalI for T7 or T3 Megascript kits, respectively. Prior to in vitro transcription, linearised plasmids were cleaned with 3 M Sodium acetate and 100% ethanol. Linear templates (1 μg) were in vitro transcribed according to manufacturer’s instructions, and RNAs were cleaned by LiCl precipitation.
Megascript t3 and t7 kits
Manufactured by Thermo Fisher Scientific
The MegaScript T3 and T7 kits are in vitro transcription kits designed for the high-yield synthesis of RNA from DNA templates. The kits contain the necessary components, including RNA polymerase enzymes, ribonucleotides, and reaction buffers, to efficiently transcribe DNA into RNA.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using megascript t3 and t7 kits
1
In vitro Transcription of Satellite DNA Repeats
2
Generating RNA Transcripts from Satellite DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MegaScript T3 and T7 kits (ThermoScientific) were used to transcribe forward and reverse transcripts of differing lengths from major satellite repeat DNA, according to the manufacturer's instructions. To obtain transcripts with one single consensus repeat, oligos containing the forward or the reverse major satellite consensus sequences were synthesised with the T7 or the T3 sequences, respectively (GenScript) and hybridised. Two repeats were transcribed using the pCR4 Maj9-2 template ( 73 ; a gift from Thomas Jenuwein), which was digested with SpeI or NotI for T7 or T3 Megascript kits, respectively. Eight repeats were transcribed from the pySat template ( 76 ; a gift from from Niall Dillon, Addgene plasmid # 39238), which was digested with NotI or SalI for T7 or T3 Megascript kits, respectively. Prior to in vitro transcription, linearised plasmids were cleaned with 3M Sodium acetate and 100% ethanol. Linear templates (1µg) were in vitro transcribed according to manufacturer's instructions, and RNAs were clean by LiCl precipitation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!