The largest database of trusted experimental protocols

Adeasy strategy

Manufactured by Agilent Technologies
Sourced in United States

The AdEasy strategy is a laboratory equipment product from Agilent Technologies. It provides a system for generating recombinant adenoviruses efficiently. The core function of the AdEasy strategy is to facilitate the construction and production of adenoviral vectors for various applications.

Automatically generated - may contain errors

2 protocols using adeasy strategy

1

Adenovirus-Mediated Expression of 4mtGCaMP6f

Check if the same lab product or an alternative is used in the 5 most similar protocols
The adenovirus expressing 4mtGCaMP6f was generated using the AdEasy strategy (Agilent). 4mtGCaMP6f (Tosatto et al., 2016 (link)) was subcloned in the pShuttle-CMV vector (Agilent) from pcDNA3.1-4mtGCaMP (Tosatto et al., 2016 (link)) using the following primers:

fw: 5′- AATTTAGATCTCCAAGCTGGCTAGCATGTCC-3′

rv: 5′- AAATTGCGGCCGCTCACTTCGCTGTCATCATTT -3′

The PCR fragment was cloned into BglII and NotI sites in pShuttle-CMV (pShuttle-CMV was a gift from Bert Vogelstein (Addgene plasmid # 16403)). Subsequent steps were performed according to the manufacturer’s instructions (Agilent).
+ Open protocol
+ Expand
2

Adenoviral Expression of Ankrd2-HA

Check if the same lab product or an alternative is used in the 5 most similar protocols
The adenovirus expressing Ankrd2-HA was created using the AdEasy strategy (Agilent Technologies, Santa Clara, CA, USA). The HA-tagged mouse Ankrd2 cDNA was cloned into the pAdTrack cytomegalovirus vector (Agilent Technologies). Subsequent steps were performed according to the manufacturer's instructions. The adenoviral vectors contain two distinct promoters that independently drive the expression of the gene of interest and GFP. The mock plasmid expresses only GFP.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!