The largest database of trusted experimental protocols

Traut s reagent

Manufactured by Merck Group
Sourced in United States

Traut's reagent is a chemical compound used in the field of molecular biology and biochemistry. It is primarily utilized for the introduction of sulfhydryl groups (-SH) onto the surface of various biomolecules, such as proteins and nucleic acids. This process, known as 'thiolation,' facilitates the subsequent attachment of these biomolecules to other molecules or surfaces.

Automatically generated - may contain errors

11 protocols using traut s reagent

1

BSA-GNRs Conjugation with Traut's Reagent

Check if the same lab product or an alternative is used in the 5 most similar protocols
The BSA-GNRs obtained in Section 2.4.1 were incubated with 6 mM 2-iminothiolane hydrochloride (Traut’s reagent, Sigma, St. Louis, MO, USA) at 25 °C for 45 min (Figure 1, step 2). To separate BSA-GNRs from the unbound Traut’s reagent, the reaction mixture was passed through a desalting column (NAP-10, GE Healthcare). Elution was performed in 20 mM K-Pi (pH 7.5). BSA-GNRs conjugated with Traut’s reagent were collected in the void volume fraction.
+ Open protocol
+ Expand
2

Chitosan-based Targeted Drug Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols
Medium molecular weight chitosan (Sigma–Aldrich, India), lauric acid (Himedia, India), EDC, bifunctional PEG (Jenkem Technology, USA), anti-CD44 mAb antibody (Novus Biologicals, USA), 4T1 cells, tumor-derived mammary endothelial cells (Cell Biologics, India), acridine orange, propidium iodide, Sytox blue nucleic acid stain, crystal violet and tubulin tracker (Molecular Probes, India) were used in the study. Traut's reagent, 2′,7′-dichlorofluorescin diacetate (DCFDA), Ellmann's reagent [5,5-dithiobis (2-nitrobenzoic acid), DTNB], were purchased from Sigma–Aldrich, India.
+ Open protocol
+ Expand
3

Histone-Mediated Photodynamic Cancer Therapy

Check if the same lab product or an alternative is used in the 5 most similar protocols
Histone was purchased from Yuanye Bio-tech (Shanghai, China). HA (MW: 100 KD) was obtained from Heowns Biochem (Tianjin, China). Traut’s reagent was supplied by Sigma-Aldrich (Saint Louis, MO, USA). Ce6 was purchased from Frontier Scientific (Logan, UT, USA). HMGB1-siRNA (sense: GCUGAAAAGAGCAAGAAAAUU; antisense: UUUUCUUGCUCUUUUCAGCCU) and FAM-labeled HMGB1-siRNA were synthesized by Sangon Biotech (Shanghai, China). Minimum essential medium (MEM), penicillin–streptomycin, fetal bovine serum (FBS), and phosphate buffered solution (PBS) were purchased from Biological Industries (Kibbutz Beit Haemek, Israel). DAPI and thiazolyl blue tetrazolium bromide (MTT) were obtained from Solarbio Sci & Tech (Beijing, China). 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) was purchased from MedChemExpress (Shanghai, China). The Live/Dead Cell Staining Kit was obtained by Bestbio Biotech (Nanjing, China). The human breast cancer cell line MCF-7 was provided by Procell Life Technology (Wuhan, China).
+ Open protocol
+ Expand
4

Multifunctional Nanoparticle Drug Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quercetin (Que), imidazole and Traut's Reagent were all purchased from Sigma-Aldrich (St. Louis, MO, USA). Triphenylphosphine (TPP) was purchased from Alfa Aesar Co., Inc. (Ward Hill, MA, USA). Sodium iodide, cesium carbonate and 1-bromo-4-chlorobutane were all purchased from J&K Co., Ltd. (Beijing, China). Alpha-maleinimido-omega-carboxy succinimidyl ester poly (ethylene glycol) (NHS–PEG–Mal, Mw = 2000 Da) was obtained from Shanghai yarebio Co., Ltd. (Shanghai, China). 4-Aminophenylboronic acid was obtained from Shanghai aladdin Co., Ltd. (Shanghai, China). Doxorubicin hydrochloride (DOX) was purchased from China Langchem Inc. (Shanghai, China). Anti-VEGF mAb was kindly provided by Prof. Yu Liu.43 RPMI 1640 and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were both purchased from KeyGEN Biotech (Nanjing, China). Fetal bovine serum (FBS) was purchased from Gibco (Burlington, ON, Canada). All other chemicals and reagents in this study were analytical grade.
+ Open protocol
+ Expand
5

Protein Labeling with EMCH Reagent

Check if the same lab product or an alternative is used in the 5 most similar protocols
First, 2 mg of ntPE-TEV-H6 protein was reacted with TEV enzyme (Life Technologies, Carlsbad, CA, USA) and a 1 mL HisTrap HP column was used to elute the cleaved protein (ntPE-CENLYFQ). A 5-fold molar excess of N-(ε-maleimidocaproic acid) hydrazide (EMCH) was reacted with ntPE at RT for 2 h prior to the removal of unreacted EMCH using dialysis (10 kDa MWCO) against PBS overnight at 4 °C. To prepare a control protein for coupling to NPs, a 3-fold molar excess of Traut’s reagent (5,5′-dithiobis(2-nitrobenzoic acid); Sigma-Aldrich, Gillinghamm, UK) was added to BSA in 12 mM PBS (pH 7.4) containing 3 mM EDTA and incubated at RT for 1 h to produce ~1 thiol group per BSA molecule prior to reaction with EMCH in a manner identical to that used for ntPE-CENLYFQ.
+ Open protocol
+ Expand
6

NADP+ Functionalization of AFM Cantilevers

Check if the same lab product or an alternative is used in the 5 most similar protocols
DFS requires the strong immobilization of the molecules at the cantilever probe for them not to unbind while withdrawing in force scans. Prefunctionalized maleimide-terminated flexible polyethyleneglycol (PEG) linker silicon nitride AFM cantilevers (MW 3400; Novascan Technologies Inc., Ames, IA, USA) were used. Nominal stiffness constant values of cantilevers ranged from 0.02 to 0.06 N/m. For NADP+ functionalization, a 2 mg/mL 2-iminethiolane solution (Traut’s Reagent; Thermo Scientific Pierce, Waltham, MA, USA) in 5 mM PBS/EDTA pH 7.2 was prepared. NADP+ (Sigma-Aldrich, San Luis, MO, USA) and Traut’s Reagent solution were mixed in a 1:10 molar ratio and incubated for 2 h at RT in the absence of light (Figure 3). Then, 150 μL of the aforementioned NADP+ mixture was added to the maleimide–PEG cantilever fixed on a capsule, and incubated overnight at 4 °C in the absence of light (Figure 3). AFM tips were washed three times (5 min each) with the same buffer and kept at 4 °C in the absence of light until use.
+ Open protocol
+ Expand
7

HDL-mimetic nanoparticles for targeted drug delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HDL-mimetic peptide-lipid nanoparticles (HPPS) which were modified by DSPE-PEG (2000) maleimide around its surface were prepared and purified as reported before [9 (link),10 (link)]. 27μl Traut’s reagent (25 mg/ml, Sigma Aldrich, USA) was mixed with 360μl anti-TfR mAb (10 mg/ml) in PBS. The mAb-SH could not be collected until 1h reaction of the mixture under a roller mixer at room temperature. Then a Ultrafiltration device (Amicon Ultra-15, 30000 MWCO, MERK) was used to remove the excess Traut’s reagent. The anti-hTfR mAb conjugated HPPS (HPPS-mAb) was prepared by mixing mAb-SH with maleimide-containing HPPS and shaking at room temperature for 20h. The nanostructure carried DIR-BOA, a near-infrared fluorescent dye as cargo. Concentration of DIR-BOA was determined from a standard curve of DIR-BOA according to the same protocol as described before [10 (link),11 (link)].
+ Open protocol
+ Expand
8

Trastuzumab-Listeriolysin O Conjugate Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Orthopyridyl disulfide functionalized polyethylene glycol
N-hydroxysuccinimide ester (OPSS-PEG-NHS, MW 5000) was purchased from Nanocs,
Inc. (New York, NY). Trastuzumab (Herceptin®) was a generous gift from
Dr. Virginia Borges (UC Denver, CO, USA). Listeriolysin O (LLO) from E.
coli
transfected with the LLO-pEt29-DP-E3570 plasmid, kindly
provided by Dr. Dan Portnoy (UC Berkeley, CA, USA), was purified by the method
described previously (13 (link),14 (link)) and stored in storage buffer (50 mM phosphate
buffer, pH 6.0, 1 M NaCl, 1 mM EDTA) without dithiothreitol (DTT) to preserve
its activity. Polylysine hydrobromide (MW 37,000; degree of polymerization: 177)
and 2-iminothiolane-HCl (Traut's reagent) were purchased from Sigma Life
Science (St. Louis, MO, USA). CL-4B Sepharose used for the purification of the
one-component complexes was purchased from Amersham Biosciences (Uppsala,
Sweden). All other reagents, unless otherwise specified, were purchased from
Thermo Fisher Scientific (Pittsburgh, PA, USA).
+ Open protocol
+ Expand
9

Thiolation of Recombinant Murine IL-10

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lysine residues, the expected sites for thiolation on IL-10, were targeted using Traut’s reagent (Sigma Aldrich). Recombinant murine IL-10 (Peprotech) was thiolated with 30 molar excess of Traut’s reagent in PBS with 5 mM EDTA (Gibco) at pH 8.0 for 1 hour, according to manufacturer’s protocol. Protein samples were then washed twice by diluting with PBS (pH 8.0) and passing through a 10 kDa cellulose filter (Amicon Ultra; Millipore) at 14,000g. To quantify the extent of thiolation, samples were stained for free thiols using the Measure-iT Thiol Quantification Kit (ThermoFisher). The fluorescence intensity (Ex/Em: 494/517nm) of thiolated IL-10 (HS-IL-10), native IL-10, blank wells, and reduced glutathione standards were quantified on a spectrophotometer, according to manufacturer’s protocol (Synergy H4; BioTek).
+ Open protocol
+ Expand
10

Malaria Diagnostic Assay Reagents

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hexaamineruthenium (III) chloride (Ru(NH3)63+), methylene blue, phosphate-buffered saline (PBS, pH 7.4), Traut’s Reagent, (ethylenedinitrilo)tetraacetic acid (EDTA), ascorbate oxidase (AO), casein, and other reagents for buffer solutions were purchased from Sigma-Aldrich (St. Louis, MO). Deionized (DI) water (18.3 MΩ-cm−1) was generated using a Smart2Pure water purification system. StabilBlock® Immunoassay Stabilizer was purchased from SurModics, Inc. (Eden Prairie, MN). Mouse monoclonal anti-PfHRP2 IgM and mouse monoclonal anti-PfHRP2 IgG were purchased from ICL, Inc. (Portland, OR). Recombinant P. falciparum histidine-rich protein 2 (PfHRP2) and P. falciparum lactate dehydrogenase (PfLDH) were purchased from CTK Biotech (San Diego, CA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!