Taq polymerase assay

The 16S-rRNA gene was amplified by PCR using primers, forward (5′ AGAGTTTGATCCTGGCTCAG 3′) and reverse (5′ GGTTACCTTGTTACGACTT 3′) (Srinivasan et al. 2015) (link). [ 22 ] Expected size of the amplified fragment [SWUNG DASH]1500 bp. Template DNA was diluted to the concentration range of 20-50 ng/μL. The PCR master mix was prepared for total reaction volume of 20 μL by adding the 14.2 μL nuclease free water, 2.0 μL Taq polymerase assay buffer, 0.5 μL MgCl 2 , 0.5 μL dNTPs, 0.5 μL of each primer (Sigma Aldrich, USA), 0.2 μL Taq DNA polymerase (Thermo Scientific, USA), and 1 μL DNA template. The following PCR conditions were used for amplification of 16S-rRNA gene: initial denaturation at 94°C for 5 min; 35 cycles of 94°C for 1 min, 52°C for 30 sec and 72°C for 1 min 40 sec; and a final extension step at 72°C for 10 min. The PCR amplified products were run by gel electrophoresis with a 0.8% agarose gel, at 80 V for 25 min. The agarose gel was prepared in 1X Sodium borate buffer and samples were run with 1kb DNA ladder as a molecular marker. The gel was then stained in Ethidium Bromide for 20-30 min., visualized under UV trans-illuminators and documented using Gel Documentation System (Bio-Rad, USA).