Rna oligonucleotides

Manufactured by Integrated DNA Technologies

Sourced in United States

RNA oligonucleotides are short sequences of ribonucleic acid (RNA) that are synthesized in a laboratory. They are used as tools for various applications in molecular biology and biochemistry research.

Automatically generated - may contain errors

Lab products found in correlation

34 protocols using rna oligonucleotides

Spectroscopic Analysis of RNA Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides were purchased from Integrated DNA Technologies and dissolved in nuclease-free water at a concentration of 100 µM. The RNA sequences were as follows: I-8 (5′-GCUUUGGUGGUGGAAUGGUGCUAUGUGG-3′), I-8-G4m (5′-GCUUUGAUGAUGAAAUGAUGCUAUGUGG-3′), G2U1 (5′-GGUGGUGGUGG-3′), G3U1 (5′-GGGUGGGUGGGUGGG-3′), NRQ (5′-GGGAGGGGCGGGUCUGGG-3′), and CRQ (5′-GGGCGGCGGGCGGGCUGGGG-3′).
For the spectroscopy measurements, RNA oligonucleotides were prepared in buffers containing 10 mM Tris-HCl (pH 7.4) in either the absence or presence of monovalent salt at a concentration of 5 µM and annealed by heating to 95°C and then cooling slowly to room temperature. CD of RNA oligonucleotides was determined at 20°C by a Jasco J-815 spectropolarimeter equipped with a temperature controller. An average of three CD spectra ranging from 220 to 320 nm was recorded in a 0.1-mm path length cuvette at a scan rate of 50 nm/min with a 2-sec response time, 1.00-nm bandwidth, and continuous scan mode.

Huang H., Zhang J., Harvey S.E., Hu X, & Cheng C. (2017). RNA G-quadruplex secondary structure promotes alternative splicing via the RNA-binding protein hnRNPF. Genes & Development, 31(22), 2296-2309.

+ Open protocol

+ Expand

Characterization of p19 siRNA Binding Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides (p19RNA-1, 5′-AUCUCAACCAGCCACUGCUAA, and p19RNA-2, 5′-AGCAGUGGCUGGUUGAGAUUU) were obtained from Integrated DNA Technologies. The 21-nt complementary strands were annealed by mixing equivalent molar amounts of each oligonucleotide, heating to 90 °C for 4 minutes, then allowing the solution to slow cool to room temperature over 30 minutes. Successful annealing was confirmed by agarose gel electrophoresis (Supp. Fig. 1A). The p19 siRNA binding protein (10 U/μL) used here was a commercially produced double-fusion protein, with a maltose binding protein fused to the N-terminus and a chitin-binding domain fused to the C-terminus (New England BioLabs). The binding properties of this double-fusion version of p19 have been previously described [32 (link)]. Twelve-microliter binding reactions were prepared with 20 ng of double-stranded RNA in 1× Binding Buffer (NEB) with varying protein concentrations. The reactions were briefly vortexed and then incubated at 25 °C for 1 hour. After incubation, 2 μL of 30% glycerol was added to each sample and, after brief vortexing, a total of 11 μL was loaded into each well of either an agarose or a polyacrylamide gel. Gels were prepared during incubation so that electrophoresis could immediately follow the binding reaction.

Ream J.A., Lewis L.K, & Lewis K.A. (2016). Rapid agarose gel electrophoretic mobility shift assay for quantitating protein:RNA interactions. Analytical biochemistry, 511, 36-41.

+ Open protocol

+ Expand

Preparation and Characterization of dsRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides were purchased from Integrated DNA Technologies (IDT) and the sequences are listed in Supplementary Table 1. A stock solution of 1 mM was prepared for single-stranded RNA (ssRNA) substrates using water. A stock solution of 2 mM was prepared for RNA oligonucleotides intended for making 5′- or 3′-overhang dsRNA in the annealing buffer (60 mM KCl, 6 mM Tris-HCl, pH 8, and 0.2 mM MgCl₂). dsRNA with overhangs was prepared by mixing an equal volume of the two RNA strands and annealed by heating to 95 °C for 5 min, followed by slow cooling to room temperature.
Formation of annealed dsRNA with overhangs using FAM labeled RNA or unlabeled RNA was verified by 20% native gel electrophoresis (acrylamide:bis-acrylamide ratio of 19:1) in 0.5X TBE buffer (40 mM Tris base, 45 mM boric acid, 1 mM EDTA) (Supplementary Fig. 1). SYBR™ Gold Nucleic Acid Gel Stain (Thermo Fisher) was used for staining unlabeled RNA (Supplementary Fig. 1b). Amersham^TM Typhoon^TM Biomolecular Imager (GE Healthcare) was used to visualize gel images.

Yang H., Kim K., Li S., Pacheco J, & Chen X.S. (2022). Structural basis of sequence-specific RNA recognition by the antiviral factor APOBEC3G. Nature Communications, 13, 7498.

+ Open protocol

+ Expand

Identification of RNA-Binding Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides labeled with biotin at the 5’-end were synthesized by Integrated DNA Technologies. The RNA sequences used in this study were listed as following, sense-M9-5’UTR-F: AGACACCTCT GCCCTCACC, sense-M9-5’UTR-F: GGTGAGGGCAGAGGTGTCT; sense-M9-3’UTR-F: TAATACGACTCACTATAGGG GGCTCCCGTCCTGCTTTGGC; sense-M9-3’UTR-R: TAAAGGTTAGAGAATCCAAG; M9-CDS-F: TAATACGACTCACTATAGGGATGAGCCTCTGGCAGCCCCT; M9-CDS-R: CTAGTCCTCAGGGCACTGCA. In all, 50 pmol Biotinylated RNA oligos were conjugated with 50 μl of streptavidin beads (50% slurry; Thermo Fisher) in a total volume of 300 μl of RNA-binding buffer (20mM Tris, 200mM NaCl, 6mM EDTA, 5mM sodium fluoride and 5mM β-glycerophosphate, PH 7.5) at 4°C on a rotating shaker for 2 hours. After washing three times with RNA-binding buffer, RNA-beads conjugates were incubated with 100 μg of nuclear extracts in 500 μl RNA-binding buffer on a rotating shaker overnight at 4°C.
The beads were then washed thoroughly three times with RNA-binding buffer, eluted with 30 μl 1 × SDS loading buffer and subjected to SDS-PAGE and western blot.

Yang M., Zhou Y., Deng H., Zhou H., Cheng S., Zhang D., He X., Mai L., Chen Y, & Chen J. (2021). Ribosomal Protein L23 Drives the Metastasis of Hepatocellular Carcinoma via Upregulating MMP9. Frontiers in Oncology, 11, 779748.

+ Open protocol

+ Expand

Oligonucleotide Synthesis and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA and RNA oligonucleotides were purchased from Integrated DNA Technologies (Coralville, IA, USA), prepared using automated synthesis using standard phosphoramidite chemistry. Each oligonucleotide was purified using 10% denaturing polyacrylamide gel electrophoresis (dPAGE) containing 7 M urea. Note that for the purification of urea-resistant DNA molecules featured in this study, DNA samples in 1× denaturing gel loading buffer at 90 °C for 5 min and then immediately loaded onto dPAGE gel. This procedure was adopted to minimize the structure formation.

Zhang W., Liu M., Lee C., Salena B.J, & Li Y. (2018). Serendipitous Discovery of a Guanine-rich DNA Molecule with a Highly Stable Structure in Urea. Scientific Reports, 8, 1935.

+ Open protocol

+ Expand

Plasmid Transfection and siRNA Delivery for FOXO3a and Nanog Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols

pECE-HA-FOXO3a (Addgene plasmid no. 1787), pECE-HA-FOXO3a.TM (Addgene plasmid no. 1788), and the pECE-HA expression plasmids were transfected into cells using Lipofectamine 3000 (Life Technologies) or FuGene 6 transfection reagents (Promega) according to the manufacturer’s instructions and analyzed 24 or 48 hours after transfection. Short interfering RNAs (siRNAs) were delivered with Lipofectamine 3000 (Life Technologies) or DharmaFECT (Dharmacon) reagents at final concentrations of 40 nM (for Nanog RNAi) and 10 nM (for FOXO3a RNAi) according to the manufacturer’s instructions (sequences used were as follows: 5′-UUC UCC GAA CGU GUC ACG U-3′ for siControl, 5′-CUU ACG CUG AGU ACU UCG A-3′ for siLuciferase, 5′-CCA GAC CUG GAA CAA UUC A-3′ for siNANOG, and 5′-AAU GUG ACA UGG AGU CCA UUA-3′ for siFOXO3a). Scrambled were used as nontargeting siRNA controls (siControl). RNA oligonucleotides were purchased from IDT Korea (Integrated DNA Technologies) and Bioneer. Experiments were performed 48 hours after transfection as Western blotting indicated protein depletion to background levels.

Aldonza M.B., Ku J., Hong J.Y., Kim D., Yu S.J., Lee M.S., Prayogo M.C., Tan S., Kim D., Han J., Lee S.K., Im S.G., Ryu H.S, & Kim Y. (2020). Prior acquired resistance to paclitaxel relays diverse EGFR-targeted therapy persistence mechanisms. Science Advances, 6(6), eaav7416.

+ Open protocol

+ Expand

Affinity Purification of RNA Interactors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-MYC, Hemagglutinin tag, DHX36, DDX5, DDX17, DHX9, DHX29 and DHX30 antibodies were purchased from Abcam, the V5-tag antibody was obtained from Source BioScience, DDX3X antibody was ordered from Santa Cruz and FXR1 antibody was purchased from Cell Signaling. RNA oligonucleotides were ordered from Integrated DNA Technologies. Streptavidin magnetic beads were obtained from Promega and Strep-Tactin magnetic nanobeads were purchased from IBA.

Herdy B., Mayer C., Varshney D., Marsico G., Murat P., Taylor C., D'Santos C., Tannahill D, & Balasubramanian S. (2018). Analysis of NRAS RNA G-quadruplex binding proteins reveals DDX3X as a novel interactor of cellular G-quadruplex containing transcripts. Nucleic Acids Research, 46(21), 11592-11604.

+ Open protocol

+ Expand

Radiolabeling and Kinetic Analysis of Nucleic Acids

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides were purchased from Integrated DNA Technologies. 2 pmol of nucleic acid were 5′ radiolabeled with T4 polynucleotide kinase (New England BioLabs) and γ-32P ATP (Perkin Elmer) in 1 × T4 polynucleotide kinase buffer for 30 min at 37 °C. The substrates were resolved on a denaturing polyacrylamide gel, visualized by autoradiography, excised from gel, and placed in a 0.3-mL solution of 0.3 M sodium acetate overnight at 4 °C followed by ethanol precipitation and resuspension in sterile water.
Kinetics analyses with radiolabeled nucleic acid substrates were carried out at 22 °C using the concentrations of 2 nM nucleic acid and 2 μM enzyme. Reactions contained 5 mM HEPES pH 7.5, 70 mM KCl, 2 mM MgCl₂, 5% (vol/vol) glycerol, 1 mM DTT, 150 μM Spermidine, and 0.02% NP-40. The reactions were stopped at indicated times with the addition of quencher dye (90% formamide, 2.5% glycerol, 0.01% SDS, 0.01% bromophenol blue, 0.01% xylene cyanol, 1 mM EDTA) and heated for 10 min at 95 °C. The samples were then run on 20% polyacrylamide denaturing gels and visualized by phosphorimaging.

Estrella M.A., Du J., Chen L., Rath S., Prangley E., Chitrakar A., Aoki T., Schedl P., Rabinowitz J, & Korennykh A. (2019). The metabolites NADP+ and NADPH are the targets of the circadian protein Nocturnin (Curled). Nature Communications, 10, 2367.

+ Open protocol

+ Expand

Circular Dichroism Analysis of RNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD measurements were performed as described before^{56 (link)}. Briefly, RNA oligonucleotides (AAAAAA, AAGAAG and AAGGAA) were synthesized by Integrated DNA Technologies and dissolved in RNAse-free water to a final concentration of 250 μM, diluted to 25 μM in CD buffer (20 mM HEPES pH 8.0, 150 mM NaCl, 1 mM Mg(OAc)₂, 1 mM TCEP), and analyzed in a J-815 (Jasco) instrument at 340–200 nm at 0.5-nm intervals. The spectra were obtained at 50 nm min⁻¹ with standard (100 mdeg) sensitivity. For each RNA, nine individual spectra were measured and averaged. A baseline of CD buffer alone was subtracted from RNA data. Plots were generated using Graphpad Prism.

Chandrasekaran V., Juszkiewicz S., Choi J., Puglisi J.D., Brown A., Shao S., Ramakrishnan V, & Hegde R.S. (2019). Mechanism of ribosome stalling during translation of a poly(A) tail. Nature structural & molecular biology, 26(12), 1132-1140.

+ Open protocol

+ Expand

Oligonucleotide Design for miRNA Analyses

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides of unedited miR-379, edited miR-379, miR-380, unedited miR-411, edited miR-411, and miR-758 were purchased from Integrated DNA Technologies, dissolved in IDTE buffer, pH 7.5 (Integrated DNA Technologies), and then diluted in 10-fold dilution series for RT-qPCR. For experiments with yeast RNA background, 100 ng total yeast RNA (#AM7118, Invitrogen, Thermo Scientific) was added during RT sample preparation. DNA oligonucleotides were purchased from Invitrogen. Two-tailed RT primers were designed based on a hairpin sequence published by Androvic et al. (2017) (link) with hemiprobes designed to bind unedited or edited miR-379, and primer arms optimized to prevent the formation of unwanted secondary structures. Secondary structures of RT primers as well as secondary structures and dimers for qPCR primers were calculated using the OligoAnalyzer tool (Integrated DNA Technologies). ZEN/Iowa Black FQ double-quenched FAM-coupled miR-379 hydrolysis probe was designed using the PrimerQuest tool (Integrated DNA Technologies) and purchased from Integrated DNA Technologies. Primers for pri-miR-379 RT-PCR were based on those published by Kawahara et al. (2008) (link), and primers for cloning were designed using the NEBuilder tool (New England Biolabs). All RNA and DNA oligonucleotide sequences are listed in Supplemental Tables 2 and 3.

Voss G., Edsjö A., Bjartell A, & Ceder Y. (2021). Quantification of microRNA editing using two-tailed RT-qPCR for improved biomarker discovery. RNA, 27(11), 1412-1424.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!