Fluorescence-activated nuclei sorting (FANS) was used to purify Sun1-GFP+ OPC nuclei from brain tissue55 (link),91 (link). Control or AtrxSox10Cre forebrain tissue was homogenized in 500 μL homogenization buffer 20 mM Tricine KOH, 25 mM MgCl2, 250 mM sucrose, 1 mM DTT, 0.15 mM spermine, 0.5 mM spermidine, 0.1% IGEPAL-630, 1× protease inhibitor cocktail (Millipore Sigma Cat# 11873580001), 1 μL/mL RNase inhibitor (Thermo Fisher Scientific Cat# 10777019). Samples were diluted to 7.5 mL with homogenization buffer and filtered through a 40 µm strainer. Filtered samples were layered on top of 7.5 mL cushion buffer consisting of 0.5 mM MgCl2, 0.88 M sucrose, 0.5 mM DTT, 1× protease inhibitor cocktail (Millipore Sigma Cat# 11873580001), 1 μL/mL RNase inhibitor (Thermo Fisher Scientific Cat# 10777019) and centrifuged at 2800 g for 20 mins at 4 °C. Nuclei were collected as a pellet, incubated for 10 min in 500 μL 4% FBS, 0.15 mM spermine, 0.5 mM spermidine, 1× protease inhibitor cocktail (Millipore Sigma Cat# 11873580001) and 1 μL/mL RNase inhibitor (Thermo Fisher Scientific Cat# 10777019) in PBS and resuspended by gentle pipetting. Nuclei were sorted using a Sony SH800 Cell Sorter and Sun1GFP+ nuclei were collected. Total RNA was immediately isolated from GFP+ nuclei with a single cell RNA purification kit (NorgenBiotek Cat# 51800).
Rnase inhibitor
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, Switzerland, United Kingdom, France, China, Canada, Lithuania, Netherlands, Sweden, Australia, Belgium, Japan, Denmark, Finland
The RNase inhibitor is a laboratory reagent designed to prevent the degradation of RNA molecules by the ribonuclease (RNase) enzyme. It functions by binding to and inactivating RNase, thereby preserving the integrity of RNA samples during various experimental procedures.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (163 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (130 mentions)
Rneasy mini kit, by Qiagen (100 mentions)
Trizol, by Thermo Fisher Scientific (65 mentions)
Multiscribe reverse transcriptase, by Thermo Fisher Scientific (53 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (44 mentions)
Protease inhibitor cocktail, by Thermo Fisher Scientific (43 mentions)
Protease inhibitor, by Thermo Fisher Scientific (41 mentions)
Dntps, by Thermo Fisher Scientific (40 mentions)
Dnase 1, by Thermo Fisher Scientific (34 mentions)
Reverse transcriptase, by Thermo Fisher Scientific (33 mentions)
Proteinase k, by Thermo Fisher Scientific (33 mentions)
Protease inhibitor cocktail, by Merck Group (31 mentions)
Mulv reverse transcriptase, by Thermo Fisher Scientific (30 mentions)
Random hexamer, by Thermo Fisher Scientific (29 mentions)
Protease inhibitor cocktail, by Roche (29 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (28 mentions)
Rnase a, by Thermo Fisher Scientific (25 mentions)
Dntp mix, by Thermo Fisher Scientific (23 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (22 mentions)
943 protocols using rnase inhibitor
1
Fluorescence-Activated Nuclei Sorting of OPCs
2
Immunoprecipitation of Protein Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The indicated plasmids were transfected into SMMC-7721 cells that had been treated with or without the proteasome inhibitor MG132. The cells were lysed in RIPA buffer (Beyotime Biotechnology) containing protease inhibitors and RNase Inhibitor (Life Technologies) and centrifuged at 16,400×g for 15 min. The supernatants were incubated with anti-FLAG or anti-HA Protein G Dynabeads (Life Technologies) overnight at 4 °C with gentle rotation. The beads were washed thrice with NT2 buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% Nonidet P-40, 1 mM MgCl2) containing protease inhibitors (Thermo Fisher Scientific Inc.) and RNase Inhibitor (Thermo Fisher Scientific Inc.) and twice with PBS containing protease inhibitors and RNase Inhibitor (Thermo Fisher Scientific Inc.). After washing, the proteins were eluted by competition with FLAG or HA peptides (Thermo Fisher Scientific Inc.). The immuno-complexes were analysed by SDS/PAGE and immunoblotting with anti-Flag, anti-HA, anti-IGF2BP1, anti-IGF2BP3 or anti-PRMT5 antibody.
3
Quantitative RT-qPCR Assay for HIV Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HIV infection levels were assessed by measuring RT activity in viral supernatants using the previously described RT activity qPCR assay 80 (link). Upon thawing, 5 μL of viral supernatant was incubated with 5 μL lysis buffer (0.25% Triton X-100, 50 mM KCl, 100 mM Tris HCl, 40% glycerol, 0.8 U/μL RNAse Inhibitor (ThermoFisher #EO0381)) for 10 min at room temperature. This mixture was then diluted with 90 μL of ultrapure water and 9.6 μL was transferred to a 384-well MicroAmp Optical plate (Applied Biosystems #4309849) as input for the assay. Per well, 10.4 μL of the following reaction mix was used: 10 μL ROX SYBR 2X MasterMix (Eurogentec #UF-RSMT-B0701), 0.1 μL 10-fold diluted RNAse Inhibitor (ThermoFisher #EO0381), 0.1 μL of MS2 RNA (Roche #10165948001), and 0.1 μL of each 100 μM primer (MS2-F: TCCTGCTCAACTTCCTGTCGAG, MS2-R: CACAGGTCAAACCTCCTAGGAATG). Plates were read on an Applied Biosystems QuantStudio 7 Real Time PCR machine.
To quantify the RT activity (mU/mL) of viral supernatants, the RT units of a concentrated stock of HIV Q23.BG505 virus were determined multiple times using a standard curve of purified HIV RT enzyme (Worthington Biochemical Corp. #LS05003). Aliquots of this titered stock of Q23.BG505 were then used as the quantitative standard curve in all assays.
To quantify the RT activity (mU/mL) of viral supernatants, the RT units of a concentrated stock of HIV Q23.BG505 virus were determined multiple times using a standard curve of purified HIV RT enzyme (Worthington Biochemical Corp. #LS05003). Aliquots of this titered stock of Q23.BG505 were then used as the quantitative standard curve in all assays.
4
Quantitative RT-qPCR Assay for HIV-1 Viral Load
5
Exosome RNase A Treatment Conditions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The exosome pellet was suspended in 500 µL PBS and a determined volume of RNase A (Thermo Scientific, MAN0012003) was added in the RNase A treatment groups to reach a final concentration of 10 µg/mL, 20 µg/mL or 30 µg/mL. And RNase inhibitor (Thermo Scientific, EO0381) was added in the RNase inhibitor treatment groups to reach a final concentration of 1 U/µL. Then the mixture was incubated at 37 °C for 1 h.
6
MicroRNA Profiling Using Megaplex RT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Megaplex™ RT primers were used for cDNA synthesis. The Megaplex™ RT primers have two primer pools for human microRNAs, pool A, and pool B, each for reverse transcription of the microRNAs contained in the microfluidic cards. The experiment was performed according to the manufacturer's specification: 0.8 μL of Primers Megaplex™ RT (10×), 0.2 μL dNTPs with dTTP (100 mm), 1.5 μL of MultiScribe™ Reverse Transcriptase (50 U/μL), 0.8 μL of 10 × RT buffer, 0.9 μL of MgCl2 (25 mM), 0.1 μL RNase Inhibitor (20 U/μL), 0.2 μL Nuclease-free water (Applied Biosystems, Life Technologies, USA). For the microRNA profile after reverse transcription, a pre-amplification was required. This was completed following the criteria of the Kit containing TaqMan Pre Amp Master Mix (2x); Megaplex PreAmp Primers (10x); and water nuclease-free. For the miR-885-5p validation assays, we used: 3.5 μL of TaqMan Universal Master Mix II (containing 0.15 μL dNTPs, 0.5 μL of MultiScribe Reverse transcriptase, 3.5 μL of 10X RT buffer, 0.095 μl of RNase Inhibitor) (Thermo Fisher Scientific, USA), 1.5 μL of the primer specific for miR-885-5p (5x), 2.5 μL of the RNA sample, and 2.08 μL of nuclease-free water.
7
Immunoprecipitation of Specific Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunoprecipitation of specific proteins was carried out according to the published method (Bhattacharyya et al., 2006) . Briefly, cells were lysed in a lysis buffer [containing 20mM Tris-HCl pH 7.4, 150mM KCl, 5mM MgCl 2 , 1 mM dithiothreitol (DTT), 1X EDTA-free protease inhibitor (Roche), 40 U/ml RNase Inhibitor (Applied Biosystems), 0.5% Triton X-100, 0.5% sodium deoxycholate] for 30 min at 4 0 C. The lysate was cleared by centrifugation at 3,000xg for 10 min. Protein G Agarose beads (Invitrogen) were blocked with 5% BSA in lysis buffer for 1h. The bead were then allowed to bind to the required antibody for 3-4 h at 4 0 C in lysis buffer, followed by addition of the lysate. A final dilution of 1:100 (anibody:lysate) was used for immunoprecipitation. All immunoprecipitations were done for 16 h at 4 0 C followed by bead washing thrice in IP Buffer 150mM KCl, 5mM MgCl 2 , 1 mM dithiothreitol (DTT), 1X EDTA-free protease inhibitor (Roche), 40U/ml RNase Inhibitor (Applied Biosystems)]. The beads were then divided into two parts; one part for RNA isolation and the other part for western blotting.
8
CLIP-seq of Ago2-bound mRNAs in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
800 Zebrafish embryos were injected with 80pg RESA library and 80pg flag-tagged Ago2, crosslinked with 254 nm UV at 30% epiboly stage (3.3hfp) for 4 min on ice, and lysed in 750μL lysis buffer (50 mM Tris–HCl, pH 7.4, 100 mM NaCl, 1% Igepal CA-630, 0.5% sodium deoxycholate, 0.1% SDS, Protease Inhibitor (Roche # 04693159001) 1 tablet/10mL, 1:1000 volume of RNAse inhibitor (ThemoFisher #AM2696)), immunoprecipitated with 100μL Anti-Flag M2 Magnetic Beads (Sigma #M8823) for 2 hours at 4 °C, and washed 5 times with lysis buffer without Protease Inhibitor. To recover bound mRNAs beads were incubated with 200μL Proteinase K buffer (100mM Tris-HCl, pH 7.4, 50mM NaCl, 10mM EDTA) with 10μL Proteinase K (Thermo Fisher) for 20 min at 37 °C with shaking at 1100RPM. RNA was extracted with Trizol reagent. The entire RNA sample was reverse transcribed. Sequencing libraries were built as described above using 8 PCR cycles for input sample and 21 cycles for Flag IP.
Read alignment was performed as above for CLIP and input. To avoid PCR artifacts, each position along the UTRs was allowed to be overlapped by only 2 read fragment starts or ends, with the exception of the first and last position in each UTR, which had no restrictions.
Read alignment was performed as above for CLIP and input. To avoid PCR artifacts, each position along the UTRs was allowed to be overlapped by only 2 read fragment starts or ends, with the exception of the first and last position in each UTR, which had no restrictions.
9
CLIP-seq of Ago2-bound mRNAs in Zebrafish
10
Optimizing lysis conditions for SUPeR-seq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The original lysis condition of SUPeR-seq consists of 0.9× PCR buffer II and 5 mM MgCl2 (Geneamp), 0.45 % NP40 (Roche), 4.5 mM DTT (Invitrogen), 0.36 U/ul RNase inhibitor (Invitrogen), 0.18 U/μl SUPERase-In (Invitrogen), 0.125 mM dNTP (Takara) and 50 nM RT primer in a total volume of 4.5 μl. When checking whether the bias on rRNA is because of the cell lysis components, we replaced the lysis buffer with conventional RT buffer which consisted of 1× First Strand Buffer (Invitrogen), 4.5 mM DTT (Invitrogen), 0.36 U/μl RNase inhibitor (Invitrogen), 0.25 mM dNTP (Takara) and 50 nM RT primer in a total volume of 4.5 μl. In both conditions, the lysis reaction set as 70 °C for 90 s on the thermocycler.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!