Primer sequences were designed and synthesized by Sangon Biotech Co., Ltd. Total RNA was extracted from liver tissues or cells by using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. Total RNA was reverse transcribed into cDNA using a PrimeScript™ RT kit (Takara Bio, Inc.), according to the manufacturer's protocol. RT-qPCR was performed using SYBR-Green mix (Takara Bio, Inc.) on an ABI Prism 7500 real-time PCR system. Thermocycling conditions were as follows: Initial denaturation at 95°C for 10 min, 40 cycles of 95°C for 30 sec and 60°C for 30 sec. Genes of each sample were amplified in triplicate. The primer sequences were as follows: LAMP2-forward (F), 5′-CUGGCUUUAAAAAAAGGAGAAAA-3′ and reverse (R), 5′-ACCCATCTCACCCATTCTTG-3′; miR221-F, 5′-CCTGAAACCCAGCAGACAA-3′ and R, 5′-CAGGTCTGGGGCATGAAC-3′; and U6-F, 5′-GCGCGTCGTGAAGCGTTC-3′ and R, 5′-GTGCAGGGTCCGAGGT-3′. The 2−ΔΔCq method (29 (link)) was used to calculate the expression of miRNA or LAMP2 normalized to U6 mRNA.
Abi prism 7500
Manufactured by Takara Bio
Sourced in Japan, United States
The ABI Prism 7500 is a real-time PCR system used for gene expression analysis and quantification. It is capable of performing rapid, precise, and sensitive real-time PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Sybr green mix, by Takara Bio (1 mentions)
Sybr green real time pcr, by Takara Bio (1 mentions)
Primescript strand cdna synthesis kit, by Takara Bio (1 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
Superscript 2 kit, by Takara Bio (1 mentions)
Prime script rt detection kit, by Takara Bio (1 mentions)
Rnaiso reagent, by Takara Bio (1 mentions)
Sybr green qpcr master mix, by Takara Bio (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Sybr premix ex taqtm kit, by Takara Bio (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions)
Reverse transcription system, by Takara Bio (1 mentions)
Sybr premix extaq mix, by Takara Bio (1 mentions)
10 protocols using abi prism 7500
1
Quantifying LAMP2 and miR221 Expression
2
Quantifying Cellular lncRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cells or tissues was extracted by TRIzol (Invitrogen, USA), and the quality of total RNA was detected at an A260/A280 ratio using quantification by NanoDrop (Thermo Scientific, USA). 1 μg of RNA was reverse-transcribed to cDNA using the PrimeScript Strand cDNA Synthesis Kit (Takara, Japan). qPCR analysis of lncRNA DRAIC, UCHL5 and NFRKB was performed on an Applied Biosystems ABI Prism 7500 sequence detection system, and RT products were quantified with SYBR Green real-time PCR (Takara, Japan). The expression of DRAIC, UCHL5 and NFRKB was normalized to that of β-Actin using the 2−ΔΔCt method. The sequences of β-Actin primers were: 5′-TGGCACCCAGCACAATGAA-3′ (forward); 5′-CTAAGTCATAGTCCGCCTAGAA-3′ (reverse). The sequences of DRAIC primers were: 5′-GTCTCAAACTCCCGACCTCA-3′ (forward); 5′-CAACCAGCTTGTGAGGCATT-3′ (reverse). The sequences of UCHL5 primers were: 5′-TTCGATGTCTCTAGGGTGGC-3′ (forward); 5′-GATCCACCTCTCGCTCTCAG-3′ (reverse). The sequences of NFRKB primers were: 5′-TGAAGACAGCTCAGATGCCA-3′ (forward); 5′-CTTGTCAAACACGCCCTTCA-3′ (reverse).
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from different tissues or protoplasts using TRIzol reagent (Invitrogen). First-strand cDNA was synthesized from 2 μg of total RNA using a SuperScript II kit (TaKaRa). RT-qPCR was performed using the ABI prism 7500 real-time PCR System with SYBR Premix Ex Taq kit (TaKaRa). The rice ubiquitin gene was used as an internal control. At least three biological replicates were analyzed. The relative gene expression level was calculated using the 2–ΔΔCT method (Livak and Schmittgen, 2001 (link)). Primers are listed in Supplemental Table S3 .
4
Quantitative RT-PCR Analysis of Mouse RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from mouse using RNAiso reagent (Takara Biotechnology). Prime-ScriptTM RT detection kit (Takara Biotechnology) were performed for real-time (RT)-PCR assays using ABI Prism 7500 sequence detection system. Relative levels of the sample mRNA expression were calculated and expressed as 2-DDCt. The primers used for qRT-PCR are shown: 5′-CCATGGCAGACGATGATCCC-3′ and 5′-GTATGGAAGTGATTGTCCAT-3′.
5
Relative Expression of Osteogenic and Glycosylation Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol (Invitrogen) and cDNA was synthesized using a SuperScript™ III reverse transcriptase kit (Invitrogen, USA). qRT-PCRs were performed on an ABI Prism 7500 with SYBR Green qPCR Master Mix (Takara, Shanghai, China). qPCR conditions were as follows: 94°C for 30 s, followed by 40 cycles of 94°C for 5 s and 60°C for 30 s. The relative expression of RUNX2, MMP13 and MGAT5 were assayed using the 2−ΔΔCt method. β-actin was used as an internal reference. Experiments were performed in triplicate. Primer sequences were as follows:
RUNX2, Forward: 5′-CCGGAATGCCTCTGCTGTTATGA-3′;
Reverse: 5′-ACTGAGGCGGTCAGAGAACAAACT-3′.
MMP13, Forward: 5′-TCCCTGCCCCTTCCCTATGG-3′;
Reverse: 5′-CTCGGAGCCTGTCAACTGTGG-3′.
MGAT5, Forward: 5′-AGGGCCATCCTGGGTTCATTA-3′;
Reverse: 5′-AAACTGCTGCGGGTTCAGATTC-3′.
β-actin, Forward: 5′-GGACATCCGCAAAGACCTGTA-3′;
Reverse: 5′-GCTCAGGAGGAGCAATGATCT-3′.
RUNX2, Forward: 5′-CCGGAATGCCTCTGCTGTTATGA-3′;
Reverse: 5′-ACTGAGGCGGTCAGAGAACAAACT-3′.
MMP13, Forward: 5′-TCCCTGCCCCTTCCCTATGG-3′;
Reverse: 5′-CTCGGAGCCTGTCAACTGTGG-3′.
MGAT5, Forward: 5′-AGGGCCATCCTGGGTTCATTA-3′;
Reverse: 5′-AAACTGCTGCGGGTTCAGATTC-3′.
β-actin, Forward: 5′-GGACATCCGCAAAGACCTGTA-3′;
Reverse: 5′-GCTCAGGAGGAGCAATGATCT-3′.
6
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from various plant organs using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. First strand cDNAs were synthesized from 2 μg total RNA using a PrimeScript 1st Strand cDNA Synthesis Kit (Takara, Dalian).
For qRT-PCR, SYBR Premix Ex TaqTM kit (Takara) was added to the reaction system and run on an ABI Prism 7500 real-time PCR system and the OsActin gene was used as an internal control. The relative expression level was calculated by 2-ΔΔCt. The primers used for BR-related genes and cell wall synthesis-related genes are listed in Additional file1 : Table S3. The PCR procedure was: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 34 s.
For qRT-PCR, SYBR Premix Ex TaqTM kit (Takara) was added to the reaction system and run on an ABI Prism 7500 real-time PCR system and the OsActin gene was used as an internal control. The relative expression level was calculated by 2-ΔΔCt. The primers used for BR-related genes and cell wall synthesis-related genes are listed in Additional file
7
Quantifying Hepatic UGT Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tumor and the adjacent normal liver tissues by using a PureLink RNA mini kit (Ambion, life technologies) and reverse-transcribed using a Primescript RT reagent kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions. The mRNA expression levels were analyzed using ABI Prism 7500 with SYBR Premix Ex Taq II (TaKaRa, Shiga, Japan). All of the RT-PCR experiments were performed in duplicate. The levels of gene transcripts were quantified using the 2-ΔΔCT method [28 (link)] and normalized to GAPDH (internal control). The primers used are shown as follows: UGT1A1, 5'-ATGCTGTGGAGTCCCAGGGC-3' , 5'-CCATTGATCCCAAAGAGAAAACC-3' ; UGT1A9, 5'-GAGGAACATTTATTATGCCACCG-3' , 5'-CCATTGATCCCAAAGAGA AAACC-3' ; UGT1A: 5'-ACTGGAACCCGACCATCGAATCTT-3' , 5'-CACCAAACAAGGGCATCATCACCA-3' ; UGT1A4: 5'-GAACAATGTATCTTTGGCCC-3' , 5'-ACCACATCAAAGGAAGTAGCA-3' ; UGT2B7: 5'-TGGTGTGGGCAGCAGAATACA-3' , 5'-AGAGCGGATGAGTTGTTGGGAT-3' ; GAPDH, 5'-GGCCTCCAAGGAGTAAGACC-3' , 5'-AGGGGAGATTCAGTGTGGTG-3' .
8
Quantitative RT-PCR Analysis of Osteogenic and Adipogenic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol reagent (Invitrogen) and cDNA was synthesized using a reverse transcription system (TaKaRa) RT-qPCR was performed on the ABI Prism 7500 real-time PCR System using SYBR Green Master Mix. GAPDH and U6 were used as the reference genes. The primer sequences are listed in Table 1 .
List of primers used in this study
| Gene | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| ALP | GACCTCCTCGGAAGACACTC | TGAAGGGCTTCTTGTCTGTG |
| BGLAP | AGCAAAGGTGCAGCCTTTGT | GCGCCTGGGTCTCTTCACT |
| RUNX2 | CCGCCTCAGTGATTTAGGGC | GGGTCTGTAATCTGACTCTGTCC |
| PPARγ | GAGGAGCCTAAGGTAAGGAG | GTCATTTCGTTAAAGGCTGA |
| C/EBPα | CGCAAGAGCCGAGATAAAGC | CACGGCTCAGCTGTTCCA |
| GAPDH | GAAGGTGAAGGTCGGAGTC | GAAGATGGTGATGGGATTTC |
| mmu-miR155 | GCTTCGGTTAATGCTAATCGTG | CAGAGCAGGGTCCGAGGTA |
| mmu-U6 | CGCTTCGGCAGCACATATAC | TTCACGAATTTGCGTGTCATC |
9
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA extracted from cells or tissues was first reverse transcribed to cDNA with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA), then analyzed on ABI Prism 7500 sequence detection system with SYBR Premix Ex Taq Mix (TaKaRa Bio Inc., Otsu, Japan) for the expression of Arl6ip5, alkaline phosphatase, osteopontin, Trap, Ctsk, Mmp9, Bip, Chop, Grp94, Pdia3, P4hb, Gadd34, Trib3, c-Fos, β-actin and Gapdh, the primers for these genes were retrieved from PrimerBank.47 (link) For mRNA expression of osterix (Mm04209856_m1), Runx2 (Mm00501580_m1), osteocalcin (Mm03413826_mH) and RANKL (Mm00441908_m1), the Taqman primers and probes indicated were used. All detections were in triplicate for each sample and data were normalized to Gapdh or β-actin levels (ΔΔcT).
10
Quantifying CDX2 and VIL1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRI Reagent (Ambion, USA) and converted to cDNA using a PrimeScript RT reagent kit (Takara, Japan). Human CDX2 (forward 5′-TTCACTACAGTCGCTACATCACC-3′; reverse 5′-TTGTTGATTTTCCTCTCCTTTGC-3′) and VIL1 (forward 5′-GGCAAGAGGAACGTGGTAGC-3′; reverse 5′-CGGTCCATTCCACTGGATGA-3′) were amplified with SYBR Green (SYBR Premix Ex Taq II, Takara, USA) in a fluorescence reader ABI Prism 7500. The following PCR parameters were used: 95 °C for 30 seconds, 40 cycles of 95 °C for 15 seconds, 55 °C for 30 seconds and finally an elongation step at 72 °C for 30 seconds. Each reaction was performed in triplicate and normalized to GAPDH. Relative expression of the target genes was determined using the 2−ΔΔCt method23 (link). Thereafter, expression was expressed as fold difference relative to that of the untreated control cells. The results are expressed as mean ± SD of representative triplicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!