Race cdna amplification kit

Total RNA was isolated from plant materials using RNAsimple Kit (No. DP419; Tiangen Biotech, Beijing, China) according to the manufacturer’s protocol. Promega M-MLV Kit (Promega, United States) and SMART rapid amplification of cDNA ends (RACE) cDNA Amplification Kit (Clontech, United States) were used for cloning the 3′- and 5′-end of DXS cDNAs, respectively. The first-strand 3′- and 5′-RACE-Ready cDNAs were prepared and used as templates for 3′- and 5′-RACE, respectively, according to the manufacturer’s protocol. For sequence analysis, DXS amino acid sequences of A. thaliana were used as queries to search for AaDXS nucleotide sequences in the expressed sequence tag (EST) database of A. annua (taxid: 35608) using tBLASTn program. Touchdown PCR was carried out to clone the 3′- and 5′-ends of AaDXS genes. Each PCR product was cloned into the pMD-18T vector (Takara, Japan) and sequenced. Subsequently, full-length cDNAs of AaDXS genes were amplified by PCR using gene-specific primers (Supplementary Table S1). Multiple sequence alignments of DXS proteins were performed using Vector-NTI Advance 11.5 software package (Invitrogen, Carlsbad, CA, United States). Phylogenetic tree of DXS proteins was constructed with MEGA version 3.0 (Kumar et al., 2004 (link)) using the neighbor-joining method with a bootstrap of 1,000 replicates (Saitou and Nei, 1987 (link)).

The 5’- and 3’-ends of GpDSR7 were isolated using RACE reactions. Gene-specific primers (S1 Table) and a RACE cDNA amplification kit (Clontech) were used. The nested PCR products from each reaction were gel purified and cloned into the pGEM-T vector (Promega) for sequencing. After assembly of the 5’-RACE and 3’-RACE fragment sequences, the ORF of GpDSR7 cDNA was amplified using specific primers (S1 Table) with the following program: 25 cycles at 94°C for 30 s, 56°C for 30 s, and 72°C for 1.5 min.
Domains of GpDSR7 were analysed using the SMART (http://smart.embl-heidelberg.de/) and Pfam (http://pfam.sanger.ac.uk/) databases. The deduced amino acid sequences of GpDSR7 and its orthologues were analysed and aligned using the ClustalW software (http://www.ebi.ac.uk/clustalw/).

The total RNA was isolated from P. haitanensis HML gametophytes with RNAisoPlus Reagent (TaKaRa Bio Inc., Otsu, Japan) according to the manufacturer’s protocol. The cDNA for the full-length sequence cloning and transcriptional analysis was synthetized by using SMARTer™ rapid amplification of cDNA ends (RACE) cDNA Amplification Kit (Clontech Laboratories, Inc., Palo Alto, CA, USA) and TaKaRa PrimeScript RT reagent kit (TaKaRa, Tokyo, Japan) according to the instruction manual, respectively.

Animals were grinded to powders in liquid nitrogen and immediately extracted using RNAiso Plus reagent (Takara). cDNA was synthesized using PrimeScript 1st strand cDNA synthesis kit (Takara) following the manufacturer’s protocol. Screening our transcriptome data of D. japonica, we obtained an EST sequence for DjAtg7 and designed 3′-RACE specific primer (5′-TGC CAG GTC ATC CAT TGA GTC AGT G-3′) and 5′-RACE specific primer (5′-CTG TAG ATC TAT CCC CGT TAG CTC C-3′) to amplify the full-length cDNA of DjAtg7. 5′-RACE and 3′-RACE were performed using a Clontech RACE cDNA amplification kit. The purified PCR products were ligated into the pMD19-T vector and the positive clone was sequenced. The assembled sequence was verified and designated as DjAtg7.

cDNA derived from pooled RNA extractions, covering stages E24–E30 as described above, was used as template in all RACE PCR amplifications. The partial coding sequence for seven of the fourteen Sof-HD gene fragments were extended towards the 5 prime end using a SMARTer (Switching Mechanism At 5′ end of RNA Transcript) RACE cDNA amplification kit (CLONTECH) according to the manufacturer's protocol, using two rounds of gene specific amplification using the following primers: SoHox1Rv1 – CGGGCCCGTGTCAGGTATTTATTGA; SoHox3Rv1 – TCTGTCGTTCGGAGAGGTTCAGCAG; SoGbxRv1 – CGCTAAGCTTCAGGTTGTGGGCAAT; PRD-class: SoDrgxRv1 - ATCCGGATAATGCGTTTGAGCGAAG; SoVsxRv1 – CCTCCGGCAGGTCTGTCTTCAGAG; SoArxRv1 - CGAGCTTCCGTAAGATCAATTCTCAAAGC; SoLhx3/4Rv1 – CCACTCTCATGTCAAGTCCGGTTTCA. Sof-Gbx, Sof-Vsx and Sof-xLox were extended towards the 3 prime end using a 5′/3′ RACE Kit, 2^nd Generation (03 353 621 001 - ROCHE) following the manufacturer's protocol using two rounds of amplification with the following gene specific primers: SoXLoxFw1 – CGAAATCTCATGCTCACCAA and SoXLoxFw2 – TACACGCGGTCAACTTCTTG; SoVsxFw1 – AGGCCCATTACCCGGATGTTTATGC and SoVsxFw2 – CCCAGCAAGACCAGTTGAGCCTTTT; SoGbxFw1 – TCTTTGACCGAGCGTTCGCAGATT.

The wheat expressed sequence tag (TC382443) belonging to PP2C family was obtained from DFCI database. The 3’-ends of the gene was acquired with the RACE cDNA amplification kit (Clontech, USA) using the primer pairs P1 (S1 Table). The full-length cDNA sequence was amplified using primer pairs P2 (S1 Table) based on the indication of DNAMAN software. The PCR products were cloned and subjected to sequence analysis by BLAST.

The RNA extraction of chrysanthemum leaves was performed by TRNzol reagent (Mylab, Beijing, China). The full-length cDNA of the DgWRKY2 sequence was obtained by PCR (polymerase chain reaction) utilizing gene-specific primers (Table 1). The RACE reactions were carried out according to the manufacturer’s protocol (Invitrogen RACE cDNA amplification kit, Clontech, Mountain View, CA, USA). The fragment generated was cloned into pEASY-T1 Cloning Kit (Transgene Biotech, Beijing, China) and sequenced.
The sequence of DgWRKY2 was analyzed by the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/gorf/gorf.html) to obtain its open reading frame (ORF). Identification of protein domains and significant sites was performed with Motifscan (http://myhits.isb-sib.ch/cgi-bin/motif_scan). The phylogenetic tree was drawn with the MEGA 5.0 program (Sudhir Kumar, Arizona State University, Tempe, AZ, USA) using the neighbor-joining method.