Take3

Manufactured by Agilent Technologies

Sourced in United States, Germany

The Take3 is a compact, multi-well plate reader from Agilent Technologies. It is designed to measure absorbance, fluorescence, and luminescence in microplate samples. The Take3 provides accurate and reliable data for a variety of applications, including cell-based assays, enzyme activity measurements, and molecular binding studies.

Automatically generated - may contain errors

Lab products found in correlation

Iscript cdna synthesis kit, by Bio-Rad (6 mentions) Rneasy mini kit, by Promega (3 mentions) Cfx96, by Bio-Rad (3 mentions) Goscript reverse transcription system, by Promega (3 mentions) Allprep kit, by Qiagen (2 mentions) Rneasy plus universal kit, by Qiagen (2 mentions) Rna cartridge kit, by Bioptic (2 mentions) Qseq100 bio fragment analyzer, by Bioptic (2 mentions) Synergy h1, by Agilent Technologies (2 mentions) Cfx96 real time system, by Bio-Rad (2 mentions) Epoch multi volume spectrophotometer, by Agilent Technologies (2 mentions) Cell counting kit 8 (cck8), by Apexbio (2 mentions) Dneasy blood and tissue kit, by Qiagen (2 mentions) Qubit rna hs assay kit, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Hieff qpcr sybr green master mix, by Yeasen (1 mentions) 1st strand cdna synthesis kit, by Yeasen (1 mentions) Synergy 4, by Agilent Technologies (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Take3 Micro-Volume Plate (95 citations) Take3 plate (49 citations) Epoch Take3 (12 citations) Take3 Multi-Volume Plate (10 citations) Take3 spectrophotometer (6 citations) Take3 module (6 citations) Synergy HT Take3 Microplate Reader (5 citations) Epoch Take3 spectrophotometer (5 citations) Take3 Trio Microplate (5 citations) Take3 micro-volume plate accessory (5 citations)

34 protocols using take3

Glucose Tolerance Test in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Glucose tolerance tests were performed by injection of intraperitoneal glucose of 5 μL/g BW of 20% dextrose (Sigma-Aldrich G8769l; 1 mg of glucose per gram of body mass). Mice were fasted for ~4 h before glucose injection. Baseline glucose was measured before the injection and 15, 30, 60, and 120 min after via tail bleed with a glucometer (Contour Next EZ). To determine fasting serum glucose and insulin levels, blood was drawn from the heart after cervical dislocation and placed at room temperature for ~10 min to clot before centrifugation at 12,500 × g for 10 min at 4°C. The top layer (serum) was placed in a separate tube and stored at -80°C until further analysis. To establish the glucose levels in the collected serum, a mouse glucose assay kit (Crystal Chem 81692) was used (according to manufacturer recommendations) and read using an Epoch plate reader (Take3, BioTek, Winooski, VT) at optical density (OD) 505 . For serum insulin analyses, a lowrange ultra-sensitive mouse insulin ELISA kit (Crystal Values are shown as a percentage of the total amount of protein in the diet.
Chem 90080) was used (using manufacturer guidelines) and read using an Epoch plate reader (Take3, BioTek, Winooski, VT) at OD 450/630 . Homeostatic model assessment of insulin resistance was calculated as previously described (Bowe et al., 2014) (link).

de Hart N.M.M.P., Petrocelli J.J., Nicholson R.J., Yee E.M., van Onselen L., Lang M.J., Bourrant P.E., Ferrara P.J., Bastian E.D., Ward L.S., Petersen B.L, & Drummond M.J. (2024). Dietary delivery of glycomacropeptide within the whey protein matrix is not effective in mitigating tissue ceramide deposition and obesity in mice fed a high-fat diet. Journal of dairy science, 107(2).

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Trizol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. We used 1st strand cDNA Synthesis kit (Yeason, Shanghai, China) to synthesize the cDNA and assessed the RNA concentration using a microplate reader (Biotek Take 3, Winooski, VT, USA). The qRT-PCR for cDNA was performed on Hieff^® qPCR SYBR^® Green Master Mix (Yeason, Shanghai, China). Beta-actin was used as an endogenous normalization reference. All the primers are shown in Supplementary Table S1.

Luan Y., Chen Y., Wang Y, & Shu M. (2023). Comprehensive Analysis of Ferroptosis Regulators with Regard to PD-L1 and Immune Infiltration in Low-Grade Glioma. International Journal of Molecular Sciences, 24(16), 12880.

+ Open protocol

+ Expand

Multi-omics Analysis of BLA Lysates

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA and DNA were extracted from BLA lysates using the Qiagen (Germantown, MD) Allprep kit. RNA concentration was measured on the Take3 (BioTek, Winooski, VT), normalized (200ng) and converted to cDNA using the iScript cDNA synthesis kit (Bio-rad). The resulting DNA was measured on the Take3 and used for meDIP and bisulfite sequencing as described below.

Devulapalli R., Jones N., Farrell K., Musaus M., Kugler H., McFadden T., Orsi S.A., Martin K., Nelsen J., Navabpour S., O’Donnell M., McCoig E, & Jarome T.J. (2021). Males and females differ in the regulation and engagement of, but not requirement for, protein degradation in the amygdala during fear memory formation. Neurobiology of learning and memory, 180, 107404.

+ Open protocol

+ Expand

Sonication and Absorbance Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Au-Cu nanofoams and Au-Cu-Pd macrobeams were sonicated using Fisherbrand Model 50 Sonic Dismembrator (Thermo Fisher Scientific, Waltham, MA, USA) on a 100% setting for 10 s prior to UV-VIS absorbance measurements. Absorbance and fluorescence was collected on a Take 3, BioTek (BioTek, Winooski, VT, USA) multi-volume plate with 2 µL sample volumes on a Synergy 4 (BioTek) microplate reader.

Burpo F.J., Nagelli E.A., Morris L.A., Woronowicz K, & Mitropoulos A.N. (2018). Salt-Mediated Au-Cu Nanofoam and Au-Cu-Pd Porous Macrobeam Synthesis. Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry, 23(7), 1701.

+ Open protocol

+ Expand

RNA Extraction and Purification from Blood

Check if the same lab product or an alternative is used in the 5 most similar protocols

500 μl blood/RNA later (50 μl blood, 450 μl RNALater) were centrifuged and resuspended in 250 μl of DEPC-treated water. RNA extraction was then performed using TRIzol (Life Technologies) reagent following the manufacturer’s protocol and the RNA pellet was finally resuspended in 20 μl DEPC-treated water. Quality and concentration of isolated RNA was evaluated using the microplate spectrophotometer Take3 (Synergy HT, BIOTEK). RNA samples were treated with TURBO™ DNase (Ambion) to remove contaminant genomic DNA and cDNA synthesis was performed using the High Capacity cDNA Reverse Transcription kit (Life Technologies), according to the manufacturer’s instruction. The efficacy of DNAse treatment was tested for each sample by RT minus PCR.

Santolamazza F., Avellino P., Siciliano G., Yao F.A., Lombardo F., Ouédraogo J.B., Modiano D., Alano P, & Mangano V.D. (2017). Detection of Plasmodium falciparum male and female gametocytes and determination of parasite sex ratio in human endemic populations by novel, cheap and robust RTqPCR assays. Malaria Journal, 16, 468.

+ Open protocol

+ Expand

Canine Genotyping via CYB5R3 Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from blood or buccal swab with a commercial kit (DNEasy Blood and Tissue Kit; Qiagen, Hilden, Germany) and quantified and checked for quality via spectrometry (Take3; BioTek Instruments Inc., Winooski, VT). The region around the CYB5R3 729 position was amplified via PCR in 20 μl reactions: 10 μl DNA polymerase master mix (AmpliTaq Gold or DreamTaq; Thermo Fisher Scientific, Madison, WI), 1 μl genomic DNA template, 0.5 μM forward primer (5′ TCCTCAGGTGAGATGGGGAA 3′), 0.5 μM reverse primer (5′ CAGAAGGCCAGCTCTCTGTC 3′). Cycling conditions were as follows: initial denaturation at 95°C for 5 minutes, then 30 cycles of 94 °C for 15 seconds, 60°C for 30 seconds, 72°C for 1 minutes, with a final extension of 72°C for 7 minutes. Amplicons were checked for size (564 bp) with gel electrophoresis and sequenced via Sanger sequencing through the University of Wisconsin Biotechnology Center. For each dog, genotype was determined by inspection of electrophoretograms.

Reinhart J.M., Ekena J., Cioffi A.C, & Trepanier L.A. (2018). A single nucleotide polymorphism in the canine cytochrome b5 reductase (CYB5R3) gene is associated with sulfonamide hypersensitivity and is overrepresented in Doberman Pinschers. Journal of veterinary pharmacology and therapeutics, 41(3), 402-408.

+ Open protocol

+ Expand

Microwave Radiation's Impact on Oxidative Gene Expression in E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

To quantitatively evaluate oxidation-related gene expression, after exposure to different doses of microwave radiation, the total RNA was extracted from treated and untreated E. coli samples using an RNeasy Mini Kit and converted to cDNA using reverse transcriptase and random primers (GoScript Reverse Transcription System, Promega, Madison, WI, USA). The same amount of total RNA was used for cDNA synthesis (Take3, Biotek, Winooski, VT, USA) as described in a previous report^{52 (link)}. The resulting cDNA was used for qPCR analysis (CFX96, Bio-Rad, Hercules, CA, USA) with primers (Macrogen, Seoul, South Korea) of 16 s rRNA (the RNA component of the small subunit, used as the house-keeping gene), SoxS, OxyR, KatG, RpoE, GroES, and DnaK.
The primer sequences used for the oxidative-related mRNA expression in E. coli were:

Genes	Forward primers [5′–3′]	Reverse primers [5′–3′]
SoxS	ATCAGACGCTTGGCGATTAC	ACATAACCCAGGTCCATTGC
OxyR	GGGAAAACTGCTGATGCTG	CGCGGAAGTGTGTATCTTCA
KatG	CGGATCTGGTGTTTGGTTCT	ACAAACTTCTCGTGGGCATC
RpoE	AGTCCCTCCCGGAAGATTTA	ACCTACCGGACAATCCATCCATGA
GroES	TGGCCGTATCCTTGAAAATG	CCGTAGCCATCGTTGAAAAT
DnaK	GAAGAAGCAGGCGACAAACT	TAGCGGCCTTTGTCTTCACCT
16S rRNA	AGAGCAAGCGGACCTCATAA	TTCATGGAGTCGAGTTGCAG

Shaw P., Kumar N., Mumtaz S., Lim J.S., Jang J.H., Kim D., Sahu B.D., Bogaerts A, & Choi E.H. (2021). Evaluation of non-thermal effect of microwave radiation and its mode of action in bacterial cell inactivation. Scientific Reports, 11, 14003.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from the CA1 lysates using the Qiagen RNeasy kit and the concentration was measured on the Take3 (BioTek). RNA was then normalized (200 ng) and used for cDNA synthesis using the iScript cDNA synthesis kit (Bio-Rad). The resulting cDNA was used for quantitative polymerase chain reaction as described below.

Farrell K., Auerbach A., Musaus M, & Jarome T.J. (2022). The epigenetic role of proteasome subunit RPT6 during memory formation in female rats. Learning & Memory, 29(9), 256-264.

+ Open protocol

+ Expand

Tumor RNA Isolation and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of tumor samples was isolated using RNeasy Plus Universal Kits (Qiagen, GER). RNA concentration was quantified using Qubit^TM RNA HS Assay Kit (ThermoFisher Scientific, USA). RNA purity and integrity were analyzed using Take3 (BioTek, USA) and the RNA Cartridge kit of the Qseq100 Bio-Fragment Analyzer (Bioptic, CHN), respectively. Then, RNA-seq libraries were constructed using VAHTS mRNA-seq V3 Library Prep Kit for Illumina (Vazyme, CHN). Libraries were sequenced on the NextSeq 550AR platform with 150 bp paired-end reads. Quality control of WES data was described in Supplementary Data 3.

Li S., Yu W., Xie F., Luo H., Liu Z., Lv W., Shi D., Yu D., Gao P., Chen C., Wei M., Zhou W., Wang J., Zhao Z., Dai X., Xu Q., Zhang X., Huang M., Huang K., Wang J., Li J., Sheng L, & Liu L. (2023). Neoadjuvant therapy with immune checkpoint blockade, antiangiogenesis, and chemotherapy for locally advanced gastric cancer. Nature Communications, 14, 8.

+ Open protocol

+ Expand

RNA Extraction and RNA-seq Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of tumor samples was isolated from the tumor tissue with RNeasy Plus Universal Kits (Qiagen, GER) according to the manufacturer's instructions. A Qubit™ RNA HS Assay Kit (Thermo Fisher Scientific, USA) was used to quantify the concentrations of the extracted RNA. The purity and integrity of the RNA were checked with Take 3 (BioTek, USA) and the RNA Cartridge kit of the Qseq100 Bio-Fragment Analyzer (Bioptic, CHN), respectively. The VAHTS mRNA-seq V3 Library Prep Kit for Illumina (Vazyme, CHN) was used to construct RNA-seq libraries. Finally, the libraries were sequenced on the NextSeq 550AR with 150 bp paired-end reads.

Zhang G., Yuan J., Pan C., Xu Q., Cui X., Zhang J., Liu M., Song Z., Wu L., Wu D., Luo H., Hu Y., Jiao S, & Yang B. (2023). Multi-omics analysis uncovers tumor ecosystem dynamics during neoadjuvant toripalimab plus nab-paclitaxel and S-1 for esophageal squamous cell carcinoma: a single-center, open-label, single-arm phase 2 trial. eBioMedicine, 90, 104515.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!