Mouse Monoclonal anti-p53 (DO-1) was purchased from Santa Cruz Biotechnology, Santa Cruz, CA, USA. Rabbit anti-CD9 and HRP-goat anti-rabbit were purchased from System Bioscience, Palo Alto, CA, USA. Rabbit Monoclonal anti-calnexin (C5C9), IC12, and mouse anti-alix were purchased from Cell Signaling, Danvers, MA, USA. SRSF10, HRP anti-mouse, and Mouse anti-GAPDH were purchased from Sigma-Aldrich, St. Louis, MO, USA. Anti-ITGB4 was purchased from Cell Signaling Technology, Danvers, MA, USA.
Mouse monoclonal anti p53 do 1
Manufactured by Santa Cruz Biotechnology
Sourced in United States
Mouse monoclonal anti-p53 (DO-1) is an antibody that recognizes the p53 protein. p53 is a transcription factor that plays a crucial role in regulating cell cycle and apoptosis. This antibody can be used to detect and study the p53 protein in various experimental applications.
Automatically generated - may contain errors
Lab products found in correlation
Multi gauge 3, by Fujifilm (2 mentions)
Mouse monoclonal anti β actin, by Merck Group (2 mentions)
Rabbit polyclonal anti xpo1, by Santa Cruz Biotechnology (2 mentions)
Rabbit polyclonal anti hsp 90a b, by Santa Cruz Biotechnology (2 mentions)
Rabbit monoclonal gapdh, by Cell Signaling Technology (2 mentions)
Rabbit monoclonal histone h3, by Cell Signaling Technology (2 mentions)
Proteoextract, by Merck Group (2 mentions)
Doxorubicin, by Merck Group (2 mentions)
Anti gapdh fl 335 rabbit monoclonal, by Santa Cruz Biotechnology (2 mentions)
Mouse anti gapdh, by Merck Group (1 mentions)
Rabbit anti cd9, by System Biosciences (1 mentions)
Mouse anti alix, by Cell Signaling Technology (1 mentions)
Hrp anti mouse, by Merck Group (1 mentions)
Pierce classic magnetic ip and co ip kit, by Thermo Fisher Scientific (1 mentions)
M per mammalian protein extraction reagent, by Thermo Fisher Scientific (1 mentions)
Image studio v3, by LI COR (1 mentions)
Donkey anti rabbit 800cw, by LI COR (1 mentions)
Gradient gel, by Bio-Rad (1 mentions)
Odyssey system, by LI COR (1 mentions)
Nutlin 3, by Merck Group (1 mentions)
15 protocols using mouse monoclonal anti p53 do 1
1
Antibody Selection for Western Blotting
2
Co-immunoprecipitation Assay for p53-MDM2 Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the Co-IP assay, the Pierce Classic Magnetic IP and Co-IP Kit from Thermo Scientific (Dagma, Carcavelos, Portugal) were used. A total of 5.0 × 105/flask A375 cells were treated with 12 and 18 μM SLMP53-2 for 4 h; after cell lysis and protein lysate separation, 300 µg of total protein was incubated with 10 µL of mouse monoclonal anti-p53 (DO-1) or mouse immunoglobulin G (IgG, negative control) from Santa Cruz Biotechnology (Frilabo, Porto, Portugal), overnight at 4 °C. The immunoprecipitation of the immunocomplexes was performed using magnetic beads. The Western blot analysis was performed, as in Section 4.6 , for detection of p53 and MDM2 in whole-cell lysate (input) and in immunoprecipitated proteins. GAPDH was used as loading control.
3
Quantifying p53 Protein Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two days prior to treatment, ~ 4 × 105 MCF‐7 cells were plated on a 6‐cm dish. Cells were treated with either 400 ng/ml neocarzinostatin (Sigma, N9162), 5 μM Nutlin‐3 (Sigma, N6287), 10 μM Nutlin‐3, or 15 μM Nutlin‐3 for 3 h. Cells were harvested by scraping and frozen in a dry ice‐ethanol bath. Cells were lysed in M‐PER Mammalian Protein Extraction Reagent (Thermo Fisher, 78501) according to manufacturer's protocol, and the concentration for each protein sample was determined by Bradford assay. Equivalent protein masses were separated by electrophoresis on 4–20% gradient gels (Bio‐Rad, 456‐1096) and blotted onto Immobilon‐P PVDF membranes (Millipore, IPVH00010). Membranes were incubated with the following primary antibodies: mouse monoclonal anti‐p53 DO‐1 (Santa Cruz Biotechnology, sc‐126) and rabbit monoclonal anti‐β‐actin 13E5 (Cell Signaling Technology, 4970). Membranes were then incubated with the following secondary antibodies: donkey anti‐mouse 680RD (LI‐COR, 926‐68072) and donkey anti‐rabbit 800CW (LI‐COR, 926‐32213). Membranes were imaged with a LI‐COR Odyssey system (LI‐COR) and quantified using LI‐COR Image Studio v3.1 software. Following background subtraction, the band measurements were normalized to β‐actin measurements in the same lane.
4
Western Blot Analysis of Cellular Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed twice in ice-cold PBS and immediately lysed in Laemmli buffer as described previously [38 (link)]. Equal amounts of cell lysates were resolved by 10% SDS/PAGE and electro-transferred onto poly(vinylidene difluoride) membrane. Immunoblot analyses were performed as described previously [19 (link)] using the primary antibodies: mouse monoclonal anti-p53 (DO-1; Santa Cruz Biotechnology, Santa Cruz, CA, USA), mouse monoclonal anti-p73 (Ab-4; NeoMarkers, Fremont, CA, USA), mouse monoclonal anti-γH2AX (2F3; BioLegend, San Diego, CA, USA), rabbit polyclonal anti-p21WAF1 (Santa Cruz Biotechnology), rabbit polyclonal anti-phospho-p53 at Ser-15 (Cell Signaling Technology, Beverly, MA, USA), rabbit polyclonal anti-RUNX2 (Cell Signaling Technology), rabbit polyclonal anti-E2F-1 (Cell Signaling Technology), rabbit polyclonal anti-PARP (Cell Signaling Technology), rabbit polyclonal anti-caspase-9 (Cell Signaling Technology) and rabbit polyclonal anti-Actin (20–33; Sigma, St Louis, MO, USA) antibodies. Immunoreactive bands were visualized by an enhanced chemiluminescence system (ECL; GE Healthcare, Little Chalfont, UK) in accordance with the manufacturer's instructions.
5
Western Blot Analysis of Signaling Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lysates were processed for Western blotting as previously described [21 (link)]. The following antibodies were used for immunoblotting: rabbit monoclonal anti-NOX4 (UOTR1B493) (Abcam, Cambridge, MA, USA); mouse monoclonal anti-p53 (DO-1) (Santa Cruz Biotechnology); rabbit monoclonal anti-phospho-SMAD3 (EP823Y) (Abcam); rabbit monoclonal anti-SMAD3 (EP568Y) (Abcam); and rabbit polyclonal anti-p300 (A300-358A) (Bethyl Laboratories, Montgomery, TX, USA).
6
Analysis of XPO1-p53 Interaction by Western Blot
7
Immunoblotting for Cell Signaling Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All primary antibodies were used at a concentration of 1 µg/ml unless otherwise indicated. The following antibodies were used in our study: mouse monoclonal anti-p53 DO-1 (1:10,000; sc-126; Santa Cruz Biotechnology), mouse monoclonal anti-MDM2 SMP14 (1:500; sc-965; Santa Cruz Biotechnology), mouse monoclonal antiGDF15 G-5 (sc-377195; Santa Cruz Biotechnology), mouse monoclonal anti-TIGAR G-2 (sc-74577; Santa Cruz Biotechnology), mouse monoclonal anti-PIG3 A-5 (sc-166664; Santa Cruz Biotechnology), mouse monoclonal anti-PUMAα/β G-3 (sc-374223; Santa Cruz Biotechnology), mouse monoclonal anti-EGFR A-10 (sc-373746; Santa Cruz Biotechnology), rabbit polyclonal anti-WIP1 H-300 (sc-20712; Santa Cruz Biotechnology), mouse monoclonal anti-BAX 6A7 (sc-23959; Santa Cruz Biotechnology), mouse monoclonal anti-AMPKB1 Z14 (sc-100357; Santa Cruz Biotechnology), and mouse monoclonal anti-tubulin β E7 (Developmental Studies Hybridoma Bank; 1:3,000). Secondary antibodies used were anti-mouse 680 RD and anti-rabbit 800 CW (Licor) and were used at a dilution of 1:5,000.
8
Western Blot Analysis of Protein Localization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot analysis was carried out as described previously.(24 (link)) The following antibodies were used: mouse monoclonal anti-p53 (DO-1; Santa Cruz Biotechnology, Santa Cruz, CA, USA); rabbit polyclonal anti-XPO1 (Santa Cruz Biotechnology); rabbit polyclonal anti-HSP-90a/b (Santa Cruz Biotechnology); rabbit monoclonal histone H3 (Cell Signaling Technologies, Beverly, MA, USA); rabbit monoclonal GAPDH (Cell Signaling Technologies); and mouse monoclonal anti-β-actin (Sigma Chemical Co., St Louis, MO, USA). Nuclear and cytoplasmic proteins were extracted using a subcellular fractionation kit (ProteoExtract; EMD Millipore, Billerica, MA, USA), according to the manufacturer's protocol. Protein lysates were also subjected to immunoprecipitation using anti-XPO1 and immunoprecipitates were subjected to Western blot analysis with anti-XPO1 or p53. Visualized blots were analyzed by the MultiGauge 3.1 software (Fujifilm, Tokyo, Japan).
9
Antibody Characterization and Validation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following commercial antibodies were used at the dilution indicated: anti-hScrib goat polyclonal antibody (Santa Cruz WB 1:1000, IHC 1:100), anti-PP1γ goat polyclonal antibody (Santa Cruz WB 1:1000), anti-PP1 Gamma/PPP1CC Antibody LS-B4960 IHC-plus (tm) rabbit polyclonal antibody (Lifespan bioscience, Inc. IHC 1:200), anti-PP1γ sheep polyclonal antibody (Abcam, WB 1:1000), anti-actin monoclonal antibody (Sigma, WB 1:5000), mouse monoclonal anti-p53 (DO-1) (Santa Cruz WB 1:500), anti-p84 mouse monoclonal antibody (Abcam, WB 1:1000), anti-E-Cadherin rabbit polyclonal antibody (Santa Cruz WB 1:500), anti-α-tubulin mouse monoclonal antibody (Abcam, WB 1:1000), mouse monoclonal anti-vimentin antibody (Santa Cruz WB 1:500).
10
cDNA Cloning and Antibody Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNAs for human ISG15 and UBCH8 and mouse UBP43 were subcloned into pFlag-CMV10 vector and/or pcDNA3-Myc vector32 (link). Human p53 cDNAs were obtained from Korean human gene bank. p53, its deletion constructs, and K-to-R mutants were subcloned into pcDNA3-HA vector and pcDNA-HisMax vector (Invitrogen)67 (link). Site-directed mutagenesis was performed as recommended by the manufacturer's instructions (Stratagene).
Antibodies used were mouse monoclonal anti-Xpress (Catalogue number P/N 46-0528, Invitrogen), mouse monoclonal anti-Flag M2 (F3165, Sigma), mouse monoclonal anti-Myc (9E10, Santa Cruz), mouse monoclonal anti-p53 (DO-1, Santa Cruz), rabbit polyclonal anti-p21 (C-19, Santa Cruz), mouse monoclonal anti-β-actin (C4, Santa Cruz), rabbit anti-phospho-p53 (9284S, Cell Signaling) and rabbit anti-acetyl-p53 (2525S, Cell Signaling). Polyclonal anti-ISG15 antibody was generated by injecting purified ISG15 protein to rabbit32 (link). shRNA were purchased from Open Biosystems. Target sequences of shRNAs for ISG15 and EFP are: 5′- CTGAGCATCCTGGTGAGGAAT -3′ for ISG15; 5′- GAACTCATCTTTGCCAGTA -3′ (5′-UTR (untranslated region) for ISG15; 5′- GAGTGAGATCCAGACCTTGAA -3′ for EFP; 5′- GCAGAACTCTCCTTGGATA -3′ (3′-UTR) for EFP. All antibodies were diluted 1:1,000 with PBS containing 0.1% Triton X-100 and 3% BSA, except anti-β-actin, which was diluted 1:2,500.
Antibodies used were mouse monoclonal anti-Xpress (Catalogue number P/N 46-0528, Invitrogen), mouse monoclonal anti-Flag M2 (F3165, Sigma), mouse monoclonal anti-Myc (9E10, Santa Cruz), mouse monoclonal anti-p53 (DO-1, Santa Cruz), rabbit polyclonal anti-p21 (C-19, Santa Cruz), mouse monoclonal anti-β-actin (C4, Santa Cruz), rabbit anti-phospho-p53 (9284S, Cell Signaling) and rabbit anti-acetyl-p53 (2525S, Cell Signaling). Polyclonal anti-ISG15 antibody was generated by injecting purified ISG15 protein to rabbit32 (link). shRNA were purchased from Open Biosystems. Target sequences of shRNAs for ISG15 and EFP are: 5′- CTGAGCATCCTGGTGAGGAAT -3′ for ISG15; 5′- GAACTCATCTTTGCCAGTA -3′ (5′-UTR (untranslated region) for ISG15; 5′- GAGTGAGATCCAGACCTTGAA -3′ for EFP; 5′- GCAGAACTCTCCTTGGATA -3′ (3′-UTR) for EFP. All antibodies were diluted 1:1,000 with PBS containing 0.1% Triton X-100 and 3% BSA, except anti-β-actin, which was diluted 1:2,500.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!