7500 thermocycler

Manufactured by Thermo Fisher Scientific

Sourced in United States

The 7500 thermocycler is a real-time PCR instrument designed for gene expression analysis and detection of nucleic acids. It features a 96-well block and supports a wide range of chemistries and applications.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

ABI 7500 Fast DX thermocyclers Applied BioSystems 7500 Fast thermocycler 7500 Real-Time PCR thermocycler ABI 7500 real-time PCR thermocycler ABI 7500 real-time thermocycler HT‐7500 thermocycler ABI 7500 Fast Real-Time PCR System thermocycler ABI 7500 Real-Time PCR system thermocycler StepOne 7500 thermocycler ABI 7500 Thermocycler System

28 protocols using 7500 thermocycler

Quantitative Analysis of DEPDC1 and KIF4A

Check if the same lab product or an alternative is used in the 5 most similar protocols

After indicated treatment, total RNA from cells was extracted using Trizol reagent (Invitrogen), and the PrimeScript® RT reagent Kit (Takara) was used to make RNA transcribed into cDNA according to the manufacturer’s instructions. Quantitative real-time PCR (RT-qPCR) was performed with SYBR Green qPCR Master Mix using a 7500 Thermocycler (Applied Biosystems). The relative expression levels of DEPDC1 and KIF4A normalized to GAPDH were calculated by the 2^−ΔΔCt method [25 (link)].

Yang M., Zhang H., Gao S, & Huang W. (2023). DEPDC1 and KIF4A synergistically inhibit the malignant biological behavior of osteosarcoma cells through Hippo signaling pathway. Journal of Orthopaedic Surgery and Research, 18, 145.

+ Open protocol

+ Expand

Quantifying miR-1323 Expression in FFPE Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purifed from formalin-fixed, paraffin-embedded tissue sections using miRNeasy FFPE Kit (Qiagen, USA) in accordance with manufacturer's protocol. RNA was quantified and purified at absorbance of 260/280 nm using NanoDrop spectrophotometer. cDNA was synthesized using the One Step PrimeScript^@ miRNA (Takara, Naha, Japan). miR-1323 quantifcation was done using SYBR^@ Premix Ex TaqTM II (Takara) Kit. qRT-PCR experiment was conducted in triplicates, normalized to U6 Small nuclear RNA and performed on the Applied Biosystems 7500 Thermocycler. Relative expression were calculated based on 2-ΔΔCt method.

Zhao H., Zheng C., Wang Y., Hou K., Yang X., Cheng Y., Che X., Xie S., Wang S., Zhang T., Kang J., Liu Y., Pan D., Qu X., Hu X, & Fan Y. (2020). miR-1323 Promotes Cell Migration in Lung Adenocarcinoma by Targeting Cbl-b and Is an Early Prognostic Biomarker. Frontiers in Oncology, 10, 181.

+ Open protocol

+ Expand

RT-PCR Detection of SARS-CoV-2

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

SARS-CoV-2 testing was performed on nasopharyngeal swab samples. Upper respiratory samples were transported in a universal transport medium for viruses. Nucleic acid extraction was performed using the NucliSens easyMAG system (bioMérieux, Boxtel, The Netherlands). A real-time reverse transcription-polymerase chain reaction was processed on Applied Biosystems 7500 thermocycler (Foster City, CA, USA) using primers and conditions described elsewhere [13 (link)].

Martinez-Guerra B.A., Gonzalez-Lara M.F., de-Leon-Cividanes N.A., Tamez-Torres K.M., Roman-Montes C.M., Rajme-Lopez S., Villalobos-Zapata G.I., Lopez-Garcia N.I., Martínez-Gamboa A., Sifuentes-Osornio J., Ortiz-Brizuela E., Ochoa-Hein E., Galindo-Fraga A., Bobadilla-del-Valle M, & Ponce-de-León A. (2021). Antimicrobial Resistance Patterns and Antibiotic Use during Hospital Conversion in the COVID-19 Pandemic. Antibiotics, 10(2), 182.

+ Open protocol

+ Expand

X Chromosome Copy Number Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

47,XXX samples having only DNA available were confirmed by PCR using TaqMan® copy variation assays (Life technology). Copy number of a gene on the X chromosome (YIPF6) was normalized to TaqMan® copy number reference assay, RNase P, on chromosome 14. Real time PCR was performed on an Applied Biosystems 7500 thermocycler. Data were analyzed using CopyCaller v2.0 software (Figure 3).

Liu K., Kurien B.T., Zimmerman S.L., Kaufman K.M., Taft D.H., Kottyan L.C., Lazaro S., Weaver C.A., Ice J.A., Adler A.J., Chodosh J., Radfar L., Rasmussen A., Stone D.U., Lewis D.M., Li S., Koelsch K.A., Igoe A., Talsania M., Kumar J., Maier-Moore J.S., Harris V.M., Gopalakrishnan R., Jonsson R., Lessard J.A., Lu X., Gottenberg J.E., Anaya J.M., Cunninghame-Graham D.S., Huang A.J., Brennan M.T., Hughes P., Illei G.G., Miceli-Richard C., Keystone E.C., Bykerk V.P., Hirschfield G., Xie G., Ng W.F., Nordmark G., Eriksson P., Omdal R., Rhodus N.L., Rischmueller M., Rohrer M., Segal B.M., Vyse T.J., Wahren-Herlenius M., Witte T., Pons-Estel B., Alarcon-Riquelme M.E., Guthridge J.M., James J.A., Lessard C.J., Kelly J.A., Thompson S.D., Gaffney P.M., Montgomery C.G., Edberg J.C., Kimberly R.P., Alarcón G.S., Langefeld C.L., Gilkeson G.S., Kamen D.L., Tsao B.P., McCune W.J., Salmon J.E., Merrill J.T., Weisman M.H., Wallace D.J., Utset T.O., Bottinger E.P., Amos C.I., Siminovitch K.A., Mariette X., Sivils K.L., Harley J.B, & Scofield R.H. (2016). X Chromosome Dose and Sex Bias in Autoimmune Diseases: Increased 47,XXX in Systemic Lupus Erythematosus and Sjögren’s Syndrome. Arthritis & rheumatology (Hoboken, N.J.), 68(5), 1290-1300.

+ Open protocol

+ Expand

RNA Isolation and Real-Time qPCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each treatment, RNA was isolated from three biological replicates by Guanidine hydrochloride/Phenol-chloroform extraction (Logemann et al., 1987 (link)). Contaminant DNA was removed using Turbo DNA-free^TM kit (ThermoFisher). cDNA was synthesized with Transcriptor First Strand cDNA Synthesis Kit (Roche) using hexamer random primers and RNA denaturation at 60°C. qPCR was performed in a 7500 thermocycler (Applied Biosystems), using NZYSpeedy qPCR Green Master Mix (2x) and specific primers (Supplementary Table 2). Expression was normalized combining 18S rRNA and SAND gene (At2g28390, described in Czechowski et al., 2005 (link)) as references.

Izquierdo Y., Muñiz L., Vicente J., Kulasekaran S., Aguilera V., López Sánchez A., Martínez-Ayala A., López B., Cascón T, & Castresana C. (2021). Oxylipins From Different Pathways Trigger Mitochondrial Stress Signaling Through Respiratory Complex III. Frontiers in Plant Science, 12, 705373.

+ Open protocol

+ Expand

Cardiomyocyte Total RNA Isolation and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cardiomyocytes after the indicated treatments and was reverse‐transcribed to cDNA using a High‐Capacity cDNA Reverse Transcription Kit (Thermo Fisher), as advised in manufacturer's protocol. The cDNA was used for qPCR with an Applied Biosystems 7500 thermocycler using Taqman gene expression assays (a complete list of assays with IDs is given in Table S1).

Severinova E., Alikunju S., Deng W., Dhawan P., Sayed N, & Sayed D. (2019). Glucocorticoid Receptor‐Binding and Transcriptome Signature in Cardiomyocytes. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 8(6), e011484.

+ Open protocol

+ Expand

Quantifying ID4 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA isolation and reverse transcription were conducted as reported previously 19. The primers for ID4 expression were 5′‐CATCCCGCCCAACAAGAAAGTCA‐3′ (forward) and 5′‐GCCGGGTCGGTGTTGAGCGCAGT‐3′ (reverse). ID4 expression was examined by RQ‐PCR in 7500 Thermo Cycler (Applied Biosystems, Foster, CA, USA) using AceQ qPCR SYBR Green Master Mix (Vazyme Biotech Co., Piscataway, NJ, USA). RQ‐PCR program was carried out at 95°C for 30 sec., followed by 40 cycles at 95°C for 10 sec., 68°C for 1 min., 72°C for 1 min. and 89°C for 30 sec. to collect fluorescence. Relative ID4 expression was calculated using the following equation:

N_{I D 4} = 2^{▵ CT I D 4 (control - sample)} \div 2^{▵ CT A B L (control‐sample)} (2^{- ▵ ▵ CT})

Zhou J., Zhang T., Li X., Ma J., Guo H., Wen X., Zhang W., Yang L., Yan Y., Lin J, & Qian J. (2017). Epigenetic dysregulation of ID4 predicts disease progression and treatment outcome in myeloid malignancies. Journal of Cellular and Molecular Medicine, 21(8), 1468-1481.

+ Open protocol

+ Expand

RNA Isolation and cDNA Synthesis in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HepG2 cells were seeded in 60 mm Petri dishes, and all of the treatments
were performed after 70% confluency. RNA was isolated with a TRIzol reagent
(Invitrogen, catalog no. 15596018) method using the provided protocol. The RNA
sample was run on gel to check the quality of RNA, and subsequently cDNA was
synthesized using a Verso cDNA synthesis kit (Thermo Scientific, catalog no.
AB1453A) according to the manufacturer’s protocol, where an equal amount
of RNA was added to each reaction. SYBR green was used from Biorad, and the
reaction was performed in an Applied Biosystems 7500 thermocycler with the
standard reaction setup. The experiments were performed as per MIQC
guidelines.

Purkait K., R.u.t.u.r.a.j., Mukherjee A, & Gupta A. (2019). ATP7B Binds Ruthenium(II) p-Cymene Half-Sandwich Complexes: Role of Steric Hindrance and Ru−I Coordination in Rescuing the Sequestration. Inorganic chemistry, 58(22), 15659-15670.

+ Open protocol

+ Expand

Quantitative PCR for Lambda DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA loss and recoveries from each experiment were ascertained via quantitative polymerase chain reaction (qPCR). Samples were amplified using SureStart Taq polymerase (Agilent, Santa Clara, CA, USA) using an Applied Biosystems 7500 thermocycler. Custom primers and Taqman probe sequences were designed for specific sequences of λ-DNA. The forward primer was (5'- GTG GAA TGA ACA ATG GAA GTC AAC AA -3'), the reverse primer was (5'- GGC AGA GTC ATA AAG CAC CTC ATT A -3') (Integrated DNA technologies), and the Taqman probe was (5'- AGG TGC TAC GGC GGC AGA GT -3') tagged with 6-FAM at the 5’-end and a MGB-NFQ quencher at the 3’-end (Applied Biosystems, Waltham, MA, USA). The resulting amplicon was 177 base pairs long. Each 25 μL reaction contained 5 μL of the purified DNA filtrates. Samples were placed in a 96-well plate (Applied Biosystems, Waltham, MA, USA), initially heated to 95°C to activate the polymerase and then cycled 40 times through 30 sec of 95°C for DNA denaturing, 5 sec of 65°C for primer annealing, and 30 sec of 72°C primer extension. qPCR generates curves of the relative fluorescence (ΔRn) after each temperature cycle. The amount of starting DNA is calculated based on the cycle at which the fluorescence in a given well reached a threshold value as shown in Fig 2.

Katevatis C., Fan A, & Klapperich C.M. (2017). Low concentration DNA extraction and recovery using a silica solid phase. PLoS ONE, 12(5), e0176848.

+ Open protocol

+ Expand

Quantifying Gene Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA as described previously [26 (link)]. Real-time quantitative PCR (RT-qPCR) was performed using AceQ qPCR SYBR Green Master Mix (Vazyme Biotech Co., Piscataway, NJ, USA) on a 7500 Thermo cycler (Applied Biosystems, CA). Reaction conditions and PCR cycling were conducted as previously described [26 (link)], adjusting only for optimized primer annealing temperatures (60 °C). PCR primers were designed using Primer Premier 6 (Premier Biosoft, Palo Alto, CA, USA), and the primer sequences were listed in Additional file 1: Table S2. The relative quantification was calculated using the ΔΔCT method and normalized to the ABL1 housekeeping gene.

Xu Z.J., Ma J.C., Zhou J.D., Wen X.M., Yao D.M., Zhang W., Ji R.B., Wu D.H., Tang L.J., Deng Z.Q., Qian J, & Lin J. (2019). Reduced protocadherin17 expression in leukemia stem cells: the clinical and biological effect in acute myeloid leukemia. Journal of Translational Medicine, 17, 102.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!